Eremogone bryophylla — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Caryophyllaceae/Eremogone

At a glance

Occurrence records11

Data sources7

Biological traits17

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Eremogone bryophylla's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF11 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Eremogone bryophylla is a flowering plant in the sandwort (Eremogone) genus. It occurs in the Himalaya of China, Tibet, Nepal, and India. It is the highest known flowering plant, occurring as high as 6180 m.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length6.5 mm

Leaf length max9 mm

Leaf length min4 mm

Plant height0.04 m

⚠ sources differ — GIFT: 0.04 m · TRY: 0.06 m

Plant height max0.05 m

Plant height min0.03 m

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Lifespan years40 years

Habitat & environment7

Climatesubalpine or subarctic

Climberself-supporting

Elevation max5 200 m

Elevation mean4 700 m

Elevation min4 200 m

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremogone bryophylla has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK341319.1 ↗795 bp

ACGT

GGGCGGTTCGCCGCTGACGACGTCGCGAGAAGTTCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGA …

Eremogone bryophylla isolate XUBo679 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcL3ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type11 records

Wild obs. + sensor11

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 3≤1 km 4>10 km 2

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Eremogone bryophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.