Eremalche parryi

(Greene) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Eremalche

At a glance

Occurrence records341

Data sources12

Biological traits14

DNA specimens12

eDNA detections18

Sources12 archives

Databases and archives Eremalche parryi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility341 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF341 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB · GoaT · TreeOfSex2n = 20

01Narrative

Eremalche parryi is a species of flowering plant in the mallow family known by the common name Parry's mallow. It is endemic to California, where it grows in several types of habitat from the Diablo Range and down the Inner South California Coast Ranges to the Transverse Ranges, and across the San Joaquin Valley.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.02 mg

Seed mass max1.02 mg

Seed mass min1.02 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eremalche parryi has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes2

GenBank sequences10

eDNA detections18

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAJ849675.1 ↗643 bp

ACGT

TCGAAACCTGCCTAGCAGAATGACCCGTGAATGTGATATCAAACAACAAAACGAGGGGGCGCGGATGCATCATTGCCCCAAACCCTCTCG …

Eremalche parryi ITS1, 5.8S rRNA gene and ITS2 (partial), specimen voucher L. Paterson s.n.no. 26 (UPS)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT · TreeOfSex

The complete instruction manual Eremalche parryi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidypolyploid inferred

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×GoaT · Tree of Sex Database · TreeOfSex · plant

GoaT · Tree of Sex Database — ↗

TreeOfSex · plant — Andreasen2012 ↗

TreeOfSex · plant — Andreasen2003 ↗

n 104×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · TreeOfSex · plant

CCDB · book-ipcn67-71 — BATES, D.M. 1967a. Chromosome numbers in the Malvales I. Gentes Herbarium 10: 39-46.

CCDB · book-ipcn75-78 — Bates 1976

TreeOfSex · plant — Andreasen2012 ↗

TreeOfSex · plant — Andreasen2003 ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type341 records

Wild obs. + sensor172

Museum / vouchered169

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 84≤1 km 11≤10 km 11>10 km 14

120 georeferenced · 52 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 2≤1 km 41≤10 km 61>10 km 8

112 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence169

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	29
Santa Barbara, US	13
Davis, US	12
San Luis Obispo, US	9
Riverside, US	7
Canadian Department of Agriculturelocation not on record	7
CASlocation not on record	4
Mexico City, MX	3
Long Beach, US	3
Angwin, US	3
Northridge, US	2
Arcata, US	2
ASUlocation not on record	2
San Jose, US	1
Irvine, US	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Los Angeles, US	1

18 institutions · 101 of 169 vouchered records shown · 68 without an institution code

09Environmental DNA18 detections

Where the DNA of Eremalche parryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)