Erastia salmonicolor — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Erastia

At a glance

Occurrence records108

Data sources5

Biological traits0

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Erastia salmonicolor's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility108 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF108 records

DNA & barcodingNCBIsequences

01Narrative

Miękusz łososiowy – gatunek grzybów z rzędu żagwiowców (Polyporales).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Erastia salmonicolor has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSAY986499.1 ↗544 bp

ACGT

TATGTGCACACCTGGCTGTTTTACTCTTACACCTCTGTGCACTACTTGTAGGATGGTTCAGTTGTTAGCTGGCTTTTTGTTAGGTCAGCT …

Hapalopilus salmonicolor internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type108 records

Wild obs. + sensor25

Museum / vouchered82

Other1

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 3≤10 km 6

10 georeferenced · 15 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 33≤1 km 13≤10 km 9>10 km 3

58 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	46
Stockholm, SE	5
Joensuu, FI	4
Philadelphia, US	4
Karlsruhe, DE	3
BDBClocation not on record	2
Toronto, CA	2
Staten Island, US	2
Trondheim, NO	2
TROMlocation not on record	1
Mlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
BioFokuslocation not on record	1
Tartu, EE	1
Göteborg, SE	1

15 institutions · 76 of 82 vouchered records shown · 6 without an institution code