Eranthemum pulchellum

Andrews · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Eranthemum

At a glance

Occurrence records599

Data sources12

Biological traits24

DNA specimens5

eDNA detections2

Sources12 archives

Databases and archives Eranthemum pulchellum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility599 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources24 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF599 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 42

01Narrative

ルリハナガサはキツネノマゴ科ルリハナガサ属の常緑低木。種小名は「美しい」を意味する。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length13 mm

Fruit length max16 mm

Fruit length min10 mm

Inflorescence length max10 cm

Inflorescence length min3 cm

Leaf length145 mm

Leaf length max200 mm

Leaf length min90 mm

Leaf width60 mm

Leaf width max80 mm

Leaf width min40 mm

Plant height2 m

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 100 m

Elevation mean1 450 m

Elevation min300 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition9 compounds

Compounds documented for Eranthemum pulchellum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Iridoids monoterpenoids3

Piperidine alkaloids1

Aminoacids1

Pyridine alkaloids1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4S,5S,6R)-2-[[(1S,4aR,7R,7aS)-7-hydroxy-7-(hydroxymethyl)-4a,7a-dihydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3S,4S,5S,6R)-2-[[(1S,4aR,7S,7aS)-7-hydroxy-7-(hydroxymethyl)-4a,7a-dihydro-1H-cyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
1-(3,4-Dihydro-5-(2R)-2-piperidinyl-1(2H)-pyridinyl)ethanone	present	NPASS
7-Hydroxy-7-(hydroxymethyl)-1,4a,7,7a-tetrahydrocyclopenta[c]pyran-1-yl hexopyranoside	present	LOTUS
Betaine	present	LOTUS
BJPDKJGEOOTNHF-LJISPDSOSA-N	present	NPASS
Choline	present	LOTUS
MGZIREWUQNMGME-VQJWOFKYSA-N	present	NPASS
Trigonelline	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eranthemum pulchellum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences7

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOL536474.1 ↗349 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Eranthemum pulchellum voucher MO:Carlsen3096 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS1★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Eranthemum pulchellum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–542n range42median42mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 427×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-indian_vol1 +2

CCDB · ipcn-api-dl — Govindarajan, T. & D. Subramanian. 1985. Karyomorphological studies in south Indian Acanthaceae. Cytologia 50: 473–482.

CCDB · book-ipcn66 — De 1966

CCDB · book-indian_vol1 — Kaur, J. 1970 Daedalacanthus nervosus T. Anders.

CCDB · book-indian_vol1 — Pathak, G.N. et al. 1949; Sarkar, A.K., Datta, N. et at. 1978

CCDB · book-indian_vol1 — De, A. 1966a

CCDB · book-fedorov — Pathak et al. 1949

CCDB · book-atlas-flowering-plants — Pathak et al. 1949

2n 441×CCDB · Cave1956

CCDB · Cave1956 — Grant

2n 541×CCDB · Cave1956

CCDB · Cave1956 — Grant

n 213×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Sarkar, A. K., N. DATTA & U. Chatterjee. 1978. Chromosomes and adaptation of some araceous members. Cell Chromosome Newslett. 1: 28.

CCDB · book-ipcn66 — De 1966

CCDB · book-ipcn67-71 — KAUR, J. 1970. Chromosome numbers in Acanthaceae v. Sci. & Cult. 36: 103-10&.

n 222×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 14

CCDB · ipcn-api-dl — Saggoo, M. I. 1983. Cytomorphological studies on plants of economic importance of Bicarpellatae from India. 259 pp.

n 111×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 12

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type599 records

Wild obs. + sensor496

Museum / vouchered102

Other1

Origin

Native2

Introduced4

Range

Area of Occupancy AOO1 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 248≤1 km 78≤10 km 35>10 km 20

381 georeferenced · 115 without coordinates

Open the mapobservation + sensor496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 25≤1 km 16≤10 km 14>10 km 2

57 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	17
QAUlocation not on record	10
Smithfield, AU	6
Miami, US	5
Antiguo Cuscatlán, SV	4
Istituto Agrario Castelnuovolocation not on record	4
University of Stellenboschlocation not on record	4
Canberra, AU	4
Bronx, US	3
Tampa, US	3
Museo Entomologico de Leonlocation not on record	3
Beijing, CN	3
Adelaide, AU	3
Palmerston, AU	3
Universität Göttingenlocation not on record	2
St. Augustine, TT	2
Guilin, CN	2
Berlin, DE	2
Saint Louis, US	2
Vancouver, CA	1
Honolulu, US	1
Pondicherry, IN	1
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	1
Durban, ZA	1
Paris, FR	1
Christchurch, NZ	1
Auckland, NZ	1
Severin-McDaniel Insect Collectionlocation not on record	1
Wuzhou, CN	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Mount Annan, AU	1
BISHlocation not on record	1
Santa Barbara, US	1

33 institutions · 96 of 102 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Eranthemum pulchellum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 14.7–23.7

Seasonal swing summer↔winter16.2 °C

Max temp (day)24.9 °C 20.5–29.2

Min temp (night)14.4 °C 9.80–19.0

Precipitation118 mm/mo 115–120

Air humidity54.3 % 54.1–54.5

Moisture balance-14.4 mm/mo -26.7–-2.20

Vapour deficit1,093 Pa 786–1,400

Wind speed3.40 m/s 3.00–3.90

Cloud cover29.7 % 17.9–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)