Eragrostis variabilis

(Gaudich.) Steud. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Eragrostis

At a glance

Occurrence records173

Data sources8

Biological traits77

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Eragrostis variabilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility173 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources77 traits

Occurrence & distributionGBIF173 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Eragrostis variabilis, appelée kāwelu en hawaïen, est une espèce de plantes de la famille des Poaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height0.91 m

⚠ sources differ — GIFT: 0.91 m · USDA: 0.914 m · TRY: 1.07 m

Life cycle & reproduction19

After harvest regrowth rateModerate

Coppice potentialNo

DeciduousnessN

Flower conspicuousNo

Life formperennial

Life spanperennial

Lifespan categoryShort

Propagated by bare rootNo

Propagated by bulbNo

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodYes

Propagated by sprigsNo

Propagated by tubersNo

Raunkiær life formhemicryptophyte

Resprout abilityNo

Seedling vigorHigh

Diet & foraging1

Parasiteindependent

Habitat & environment23

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatemontane tropical

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureFine

Growth formherb

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassYes

Root depth min12 in

Shape and orientationErect

Small grainYes

Woodinessnon-woody

Physiology & chemistry16

Anaerobic toleranceLow

C:N ratioLow

Caco3 toleranceNone

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementMedium

Fire resistantNo

Frost free days min365 days

Nitrogen fixation levelNone

Precipitation max70 in

Precipitation min17 in

Shade toleranceHigh

Soil pH max6 pH

Soil pH min5 pH

Specific leaf area (SLA)8.33 mm²/mg

Temperature min40 °F

Uses & economy12

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityNo Known Source

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits5

Fall conspicuousNo

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max20 000 per acre

Planting density min5 120 per acre

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis variabilis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKU530242.1 ↗814 bp

ACGT

TTTATGCGTTTGCCCATGATTATGGATTAAATGGTTCGGAACCTGTGGAAATTTTTGGTTGTAATAACAAGAAATTTAGTTCACTACTTG …

Eragrostis variabilis voucher GRIN PI 642849 maturase K (matK) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Eragrostis variabilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 201×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Carr 1978

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type173 records

Wild obs. + sensor82

Museum / vouchered91

Range

Area of Occupancy AOO372 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 33≤1 km 2≤10 km 2>10 km 22

59 georeferenced · 23 without coordinates

Open the mapobservation + sensor82

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 2≤1 km 12≤10 km 6>10 km 5

25 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	43
Honolulu, US	33
Claremont, US	6
University of Stellenboschlocation not on record	4
Auckland, NZ	2
CASlocation not on record	1
Salvador, BR	1
Bloomington, US	1

8 institutions · 91 of 91 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)