Eragrostis pilosa
(L.) P.Beauv. · speciesAt a glance
Occurrence records17 809
Data sources10
Biological traits46
DNA specimens38
eDNA detections20
Sources10 archives
Databases and archives Eragrostis pilosa's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility17 809 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources46 traits
Occurrence & distributionGBIF17 809 records
Environmental DNA1 datasets · 8 countries20 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB2n = 40
01Narrative
Das Elb-Liebesgras oder Elbe-Liebesgras (Eragrostis albensis) ist eine Pflanzenart aus der Familie der Süßgräser (Poaceae). Dieses kleine Gras wächst in Mitteleuropa in Spülsaumgesellschaften (Fluss-Meldenfluren) von Strömen.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology11
Fruit length0.8 mm
Leaf length115 mm
Leaf size165 mm²
⚠ sources differ — AusTraits: 165 mm² · LEDA: 551 mm² · GIFT: 551 mm²
Leaf width3 mm
Plant height0.35 m
⚠ sources differ — GIFT: 0.35 m · AusTraits: 0.5 m · LEDA: 0.1 m · TRY: 0.25 m
Plant height generative0.2 m
Plant height max0.69 m
Plant height min0.05 m
Seed mass0.05 mg
⚠ sources differ — TRY: 0.05 mg · AusTraits: 0.045 mg · LEDA: 0.065 mg · GIFT: 0.06 mg
Seed mass max0.07 mg
Seed mass min0.04 mg
Life cycle & reproduction15
Deciduousnessdeciduous
Dispersal typeself
⚠ sources differ — AusTraits: barochory · LEDA: agochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Flowering timeyynnnnnnyyyy
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number438
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Mycorrhiza typePh.th.end.
Woodinessnon-woody
Physiology & chemistry4
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Seed longevity index0
Specific leaf area (SLA)33.53 mm²/mg
Other traits1
Diaspore typefruit
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis pilosa has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes7
GenBank sequences10
eDNA detections20
Countries9
The DNA barcodea real sequence read deposited for this species
CGCCAAAAGACACTCCCCACCAATCATGGTGCGGATGTGGAATTTGGCTCCCCGTGCCACACGGTGCGGTGGGCCGAAGTTGGGGCCGCC …
Eragrostis pilosa voucher ZY-58 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★trnL-F★ITS6★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Eragrostis pilosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidypolyploid inferred
Chromosome records20–602n range40median40mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4010×CCDB · iapt · CCDB · iber-fl · CCDB · fl-europaea +4
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · fl-europaea — Fernandes & Queiros,
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-indian_vol2 — Ono, H. & Tateoka, T. 1953 ; Tateoka, T. 1954, 1965a; Mehra, l'.N. et al. 1968 ; Fernandes, A. & Queiros, M. 1969; Christopher, J. & Abraham, A. 1974
CCDB · book-atlas-flowering-plants — Ono & T. 1953
CCDB · CromoCat 2015 — Chepinoga, V.V., Gnutikov, A. A., Enuschenko, I. V. & Rosbakh, S. A. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1281-1282
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 204×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-indian_vol2 +1
CCDB · slov-fl — Murín A., Svobodová Z., Májovský J. & Feráková V., 1999: Chromosome numbers of some species of the Slovak flora. - Thaiszia - J. Bot., Košice 9/1: 31-40.
CCDB · ipcn-api-dl — Murín, A., Z. Svobodová, J. Májovský & V. Feráková. 1999. Chromosome numbers of some species of the Slovak flora. Thaiszia 9(1): 31–40.
CCDB · book-indian_vol2 — Baquar, S.R. & Saeed, M. 1969
CCDB · CromoCat 2015 — Murín, A., Z. Svobodová, J. Májovský & V. Feráková (1999). Chromosome numbers of some species of the Slovak flora Thaiszia 9(1): 31-40
2n 603×CCDB · book-ipcn65 · CCDB · book-indian_vol2 · CCDB · Cave1962
CCDB · book-ipcn65 — Tateoka 1965c
CCDB · book-indian_vol2 — Bowden, W.M. & Senn, H.A. 1962
CCDB · Cave1962 — Bowden & Senn 1962
2n 351×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)
2n 501×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mukherjee, P. 1977b, 1978
n 2010×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). I. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 29-66(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, R. Tormo, A. Muñoz, M. C. Viera, J. Carrasco, A. Ortega & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., sér. 2 63: 153–205.
CCDB · ipcn-api-dl — Moinuddin, M., A. A. Vahidy & S. I. Ali. 1994. Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 784–791.
CCDB · ipcn-api-dl — Rao, P. N. & L. A. Mwasumbi. 1981. In Chromosome number reports LXX. Taxon 30: 79–80.
CCDB · book-ipcn73-74 — CHRISTOPHER, J., & A. ABRAHAM. 1974. Studies on the cytology and phylogeny of South Indian grasses. II. Sub-family Eragrostoideae. Cytologia 39: 561-571.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
CCDB · CromoCat 2015 — Devesa, J.A., Ruiz, T., Tormo, R., Muñoz, A., Viera, M. C., Carrasco, J., Ortega, A. & Pastor, J. (1990). Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., Sér. 2 63:153-205
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · CromoCat 2015 — Rao, P. N. & L. B. Mwasumbi. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXX]. Taxon 30(1): 79-80.
n 184×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 58–59.
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1983). SOCGI plant chromosome number reports -- I J. Cytol. Genet. 18: 58-59
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
n 103×CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — BAQUAR, s.R., & M. SAEED. 1969. Chromosome studies and polyploidy analysis in grasses of West Pakistan. I. Caryologia 22: 103-111.
CCDB · book-ipcn67-71 — BAQUAR, S.R . & M. SAEED. 1969. Chromosome ~tudies and polyploidy analysis in grasses of West Pakistan I. Caryologia 22: 103-111.
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
n 152×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bir, S. S. & C. Singh. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 60–61.
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1983). SOCGI plant chromosome number reports -- I J. Cytol. Genet. 18: 58-59
n 252×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Mukherjee 1977
CCDB · book-ipcn75-78 — Mukherjee 1978
n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S. & Chauhan, H. S. (1990a). SOCGI plant chromosome number reports-X J. Cytol. Genet. 25:147-148
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type17 809 records
Wild obs. + sensor11 748
Museum / vouchered5 940
Cultivated / captive15
Other106
Origin
Native106
Introduced614
Range
Area of Occupancy AOO35 836 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy23% within 1 km
≤100 m 1 119≤1 km 1 060≤10 km 6 964>10 km 344
9 487 georeferenced · 2 261 without coordinates
Open the mapobservation + sensor11 748
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 392≤1 km 464≤10 km 1 281>10 km 136
2 273 georeferenced · 3 667 without coordinates
Open the institutions mapphysical evidence5 940
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 3
4 georeferenced · 11 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions218 of 432 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 249 |
| Brisbane, AU | 146 |
| Bronx, US | 123 |
| Canberra, AU | 118 |
| Saint Louis, US | 110 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 105 |
| Kew, GB | 105 |
| Museo Entomologico de Leonlocation not on record | 102 |
| Moscow State Universitylocation not on record | 92 |
| NSMKlocation not on record | 90 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 87 |
| Bern, CH | 86 |
| Zürich, CH | 85 |
| Provincia di Livornolocation not on record | 81 |
| University of Stellenboschlocation not on record | 77 |
| Berlin, DE | 76 |
| CJBGlocation not on record | 71 |
| Xiamen, CN | 68 |
| Kunming, CN | 63 |
| Paris, FR | 63 |
| New Haven, US | 63 |
| Mount Annan, AU | 61 |
| Philadelphia, US | 56 |
| UNIVASFlocation not on record | 55 |
| Chongqing Museumlocation not on record | 55 |
| Wuzhou, CN | 53 |
| Pretoria, ZA | 52 |
| Nagano City, JP | 52 |
| Sanda, JP | 51 |
| Guangzhou, CN | 51 |
| Zürich, CH | 48 |
| BDBClocation not on record | 47 |
| Yangling, CN | 45 |
| SLU Artdatabankenlocation not on record | 44 |
| BClocation not on record | 41 |
| Irkutsk State Universitylocation not on record | 40 |
| MeiseBGlocation not on record | 39 |
| Universität Basel, Herbariumlocation not on record | 39 |
| Odawara, JP | 37 |
| Frankfurt am Main | 35 |
| BRNUlocation not on record | 34 |
| Shinshu Universitylocation not on record | 34 |
| KMCClocation not on record | 34 |
| Adelaide, AU | 33 |
| Université de Bordeauxlocation not on record | 31 |
| Hobart, AU | 31 |
| Nanjing, CN | 30 |
| GJOlocation not on record | 30 |
| Barcelona, ES | 30 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 29 |
| Durango, MX | 28 |
| KR | 28 |
| GMBAlocation not on record | 28 |
| Davis, US | 27 |
| San Isidro, AR | 26 |
| Baroda, IN | 25 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 25 |
| Austin, US | 25 |
| Uniwersytet Wrocławskilocation not on record | 24 |
| Logan, US | 24 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Salamanca, ES | 23 |
| Wlocation not on record | 23 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 23 |
| Chengdu, CN | 22 |
| Tsukuba, JP | 22 |
| Palmerston, AU | 21 |
| GZUlocation not on record | 21 |
| Urumqi, CN | 21 |
| LDlocation not on record | 21 |
| UFMSlocation not on record | 21 |
| Aarhus, DK | 20 |
| Chengdu, CN | 20 |
| ENTClocation not on record | 19 |
| Tampa, US | 19 |
| KIRMlocation not on record | 18 |
| Williamsburg, US | 18 |
| Helsinki, FI | 18 |
| UNINE:NEUlocation not on record | 17 |
| Bloomington, US | 16 |
| Córdoba, AR | 16 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 16 |
| Pondicherry, IN | 16 |
| UFERSAlocation not on record | 16 |
| St. Augustine, TT | 15 |
| Badajoz, ES | 15 |
| South Kensington, GB | 15 |
| Istituto Agrario Castelnuovolocation not on record | 15 |
| University of New Hampshirelocation not on record | 15 |
| Salzburg, AT | 14 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 14 |
| Dresden, DE | 14 |
| Riverside, US | 14 |
| Nijmegen, NL | 14 |
| Cenargenlocation not on record | 14 |
| Taipei, TW | 14 |
| Kochi, JP | 14 |
| Northeastern Forestry Universitylocation not on record | 14 |
| Université de Strasbourglocation not on record | 13 |
| Kyoto Universitylocation not on record | 13 |
| ASUlocation not on record | 13 |
| Brasília, BR | 13 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 13 |
| EFGlocation not on record | 13 |
| Tomioka, JP | 13 |
| Fort Worth, US | 12 |
| MAlocation not on record | 12 |
| Zapopan, MX | 12 |
| Allentown, US | 12 |
| Blumenau, BR | 12 |
| PRClocation not on record | 12 |
| Loja, EC | 11 |
| Awka, NG | 11 |
| IWEP FEB RASlocation not on record | 11 |
| WAGlocation not on record | 11 |
| Universidad Nacional de Colombia (UNAL)location not on record | 11 |
| Akita Prefectural Museumlocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Brasília, BR | 11 |
| DMZ botanic gardenlocation not on record | 11 |
| Laboratorio de Ictiologialocation not on record | 11 |
| UnBlocation not on record | 10 |
| Staten Island, US | 10 |
| Denver, US | 10 |
| Chapingo, MX | 10 |
| Nagatoro-machi, Chichibu-gun, JP | 10 |
| WNNUlocation not on record | 10 |
| Bando, JP | 10 |
| Durban, ZA | 10 |
| UNESP-ISlocation not on record | 10 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 10 |
| Kensington, AU | 10 |
| Montecillo, Texcoco, MX | 9 |
| Torreón, MX | 9 |
| HNBlocation not on record | 9 |
| James Cook Townsvillelocation not on record | 9 |
| Jena Microbial Resource Collectionlocation not on record | 9 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Tianjin Natural History Museumlocation not on record | 9 |
| Guasave, MX | 9 |
| Cape Town, ZA | 9 |
| International Salmonella Centre (W.H.O.)location not on record | 9 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 9 |
| Wuhan, CN | 8 |
| TAIElocation not on record | 8 |
| Mexico City, MX | 8 |
| Guilin, CN | 8 |
| Ciudad Autónoma de Buenos Aires, AR | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| Montréal, CA | 8 |
| UFESlocation not on record | 8 |
| Smithfield, AU | 8 |
| Federal University of Espírito Santolocation not on record | 8 |
| Ann Arbor, US | 7 |
| Bourges, FR | 7 |
| UFRPElocation not on record | 7 |
| Xining, CN | 7 |
| Museu Paraense Emílio Goeldilocation not on record | 7 |
| Central China Normal Universitylocation not on record | 7 |
| Universität Tübingenlocation not on record | 7 |
| Millersville, US | 7 |
| Yaoundé, CM | 7 |
| Auckland, NZ | 7 |
| Miami, US | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Chapel Hill, US | 6 |
| Toronto, CA | 6 |
| CEPLAClocation not on record | 6 |
| Oskarshamn, SE | 6 |
| Fukushima Universitylocation not on record | 6 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 6 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 6 |
| Elocation not on record | 6 |
| Osaka, JP | 6 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 6 |
| Mexico City, MX | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| JBRJlocation not on record | 5 |
| Naturalis Biodiversity Centerlocation not on record | 5 |
| BAlocation not on record | 5 |
| Feira de Santana, BR | 5 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 5 |
| UFSMlocation not on record | 5 |
| Salvador, BR | 5 |
| Forest Herbarium Ibadan (FHI)location not on record | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Sendai, JP | 5 |
| Naturama Aargaulocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| Université National du Béninlocation not on record | 5 |
| Guangzhou, CN | 5 |
| Texas Lutheran Universitylocation not on record | 5 |
| CPATSAlocation not on record | 4 |
| UFPElocation not on record | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| Zhengzhou, CN | 4 |
| Lausanne, CH | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Jackson, US | 4 |
| Corrientes, AR | 4 |
| Criciúma, BR | 4 |
| BAYLUlocation not on record | 4 |
| Universidade Federale do Rio Grande do Sullocation not on record | 4 |
| Omachi Alpine Museumlocation not on record | 4 |
| Archäologie und Museum Baselland - Museum.BLlocation not on record | 4 |
| Masindi, UG | 4 |
| UNESClocation not on record | 4 |
| Fujian Institute of Subtropical Botanylocation not on record | 4 |
| Dhaka, BD | 4 |
| Vancouver, CA | 4 |
| València, ES | 4 |
| Oulu, FI | 4 |
| Claremont, US | 4 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 4 |
| Xian, CN | 4 |
| GAlocation not on record | 4 |
| Shenyang Agricultural Universitylocation not on record | 4 |
| Jiangxi College of Educationlocation not on record | 4 |
| Toyama, JP | 4 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 4 |
| Johnson City, US | 4 |
| Juriquilla, MX | 4 |
| Museo Achille Folettolocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Davenport, US | 3 |
| Taipei, TW | 3 |
| Taipei, TW | 3 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Ciudad de México, MX | 3 |
| Seoul, KR | 3 |
| Norfolk, US | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Armidale, AU | 3 |
| San Diego, US | 3 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 3 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 3 |
| Chaguaramas, TT | 3 |
| UFBAlocation not on record | 3 |
| Batemans Bay, AU | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Santa Barbara, US | 3 |
| Shanghai, CN | 3 |
| UFSClocation not on record | 3 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Wuhan, CN | 3 |
| San Angelo, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Otaru, JP | 3 |
| Durham, US | 3 |
| CNF-UFHBlocation not on record | 3 |
| Edmonton, CA | 3 |
| Porrentruy, CH | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| Santa Cruz de la Sierra, BO | 2 |
| US | 2 |
| Tuscaloosa, US | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Washington, US | 2 |
| JP | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| UEMlocation not on record | 2 |
| Coimbra, PT | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| San Luis Obispo, US | 2 |
| BRLUlocation not on record | 2 |
| Northridge, US | 2 |
| H-Hohlalocation not on record | 2 |
| Phoenix, US | 2 |
| New Brunswick, US | 2 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 2 |
| Stockholm, SE | 2 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 2 |
| Corvallis, US | 2 |
| Cambridge, US | 2 |
| Christchurch, NZ | 2 |
| Flagstaff, US | 2 |
| Linares, MX | 2 |
| Madrid, ES | 2 |
| sonstHerblocation not on record | 2 |
| Albuquerque, US | 2 |
| Culiacán, MX | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Honolulu, US | 2 |
| Moscow, US | 2 |
| Provo, US | 2 |
| Londrina, BR | 2 |
| Cuiabá, BR | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| Fayetteville, US | 2 |
| S. Laegaard "location not on record | 2 |
| Philadelphia, US | 2 |
| UFABClocation not on record | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| EL PASO, US | 2 |
| IPA/SPlocation not on record | 2 |
| Tokushima, JP | 2 |
| Vitoria, ES | 2 |
| UFMGlocation not on record | 2 |
| Fortaleza, BR | 2 |
| Uppsala, SE | 2 |
| ISAlocation not on record | 2 |
| WTUlocation not on record | 2 |
| US | 2 |
| ZRC-SAZUlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Université du Lomélocation not on record | 1 |
| Pullman, US | 1 |
| Frauenfeld, CH | 1 |
| Russellville, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Pamplona, ES | 1 |
| IDElocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Asheville, US | 1 |
| Pittsburg, US | 1 |
| Pamplona, ES | 1 |
| Cincinnati, US | 1 |
| Clemson, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Long Beach, US | 1 |
| FUVATESlocation not on record | 1 |
| Portland, US | 1 |
| Tilburg, NL | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| DNSMlocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Sion, CH | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Chicago, US | 1 |
| Shenzhen, CN | 1 |
| Ivano-Frankivsk, UA | 1 |
| Yunnan Universitylocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| Nishihara, JP | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| Puebla, MX | 1 |
| Elikins, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Brussels, BE | 1 |
| Ixtacuixtla de Mariano Matamoros, MX | 1 |
| Santa Maria, BR | 1 |
| Acadia Universitylocation not on record | 1 |
| Jaén, ES | 1 |
| Cape Town, ZA | 1 |
| National Range Agencylocation not on record | 1 |
| CASlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Haramaya Universitylocation not on record | 1 |
| BISHlocation not on record | 1 |
| RABATlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| San Jose, US | 1 |
| Dekalb, US | 1 |
| BioFokuslocation not on record | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Morgantown, US | 1 |
| Peking Universitylocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Cochabamba, BO | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Hermosillo, MX | 1 |
| ifplocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| Lanzhou, CN | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Guatemala City, GT | 1 |
| UEGlocation not on record | 1 |
| GB | 1 |
| Glocation not on record | 1 |
| Denton, US | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Mississippi State, US | 1 |
| Nishihara, JP | 1 |
| Calabar, NG | 1 |
| AUAlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Singapore Botanic Gardenslocation not on record | 1 |
| Columbia, US | 1 |
| Turku, FI | 1 |
| Knoxville, US | 1 |
| University of Hamburglocation not on record | 1 |
| VENlocation not on record | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| Córdoba, ES | 1 |
| Santa Cruz, US | 1 |
| BFLlocation not on record | 1 |
| LfUlocation not on record | 1 |
| Waverly, US | 1 |
| Whitehorse, CA | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| H-Diewaldlocation not on record | 1 |
| College Park, US | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Austin, US | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Santarém, BR | 1 |
| Campo Mourão, BR | 1 |
| Fulda, DE | 1 |
| Brussel, BE | 1 |
| HACAMlocation not on record | 1 |
| National Museums of Kenyalocation not on record | 1 |
| Dehra Dun, IN | 1 |
| Kushiro City Museumlocation not on record | 1 |
432 institutions · 5 461 of 5 940 vouchered records shown · 457 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Eragrostis pilosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map8 countries0
Phenology=FFLred soil
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.8 °C 11.4–24.0
Seasonal swing summer↔winter14.9 °C
Max temp (day)20.7 °C 14.6–28.6
Min temp (night)13.2 °C 7.00–20.2
Precipitation94.2 mm/mo 57.7–131
Air humidity59.8 % 56.1–63.5
Moisture balance-15.9 mm/mo -79.4–39.1
Vapour deficit801 Pa 541–1,338
Wind speed2.90 m/s 2.10–4.90
Cloud cover39.1 % 12.0–46.2
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.