Eragrostis pectinacea
(Michx.) Nees · speciesAt a glance
Occurrence records8 857
Data sources9
Biological traits38
DNA specimens25
eDNA detections13
Sources9 archives
Databases and archives Eragrostis pectinacea's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 857 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics25 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Occurrence & distributionGBIF8 857 records
Environmental DNA1 datasets · 3 countries13 detections
DNA & barcodingBOLD · NCBI25 specimens
Genome at a glanceCCDB2n = 60
01Narrative
Eragrostis pectinacea adalah sebuah spesies rumput yang dikenal karena nama umum tufted lovegrass. Tumbuhan tersebut berasal dari benua Amerika, tersebar dari Kanada sampai Argentina.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesLEDAGIFTWCVPTRY
Size & morphology13
Leaf length max50 mm
Leaf width3 mm
Leaf width max3 mm
Leaf width min3 mm
Plant height0.414 m
Plant height max0.25 m
Plant height min0.15 m
Seed length0.8 mm
Seed length max0.8 mm
Seed length min0.8 mm
Seed mass0.089 mg
⚠ sources differ — TRY: 0.089 mg · GIFT: 0.149 mg
Seed mass max0.21 mg
Seed mass min0.089 mg
Life cycle & reproduction9
Deciduousnessn.d.
Dispersal typeself
⚠ sources differ — LEDA: chamaechor · GIFT: anemochorous
Flowering endSep
Flowering startJun
Life formannual
Life spanannual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTÁrea Antrópica
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio10.43 g/g
Leaf c465 mg/g
Leaf dry-matter content (LDMC)318 mg/g
Leaf n17.22 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)22.68 mm²/mg
05DNA & barcoding25 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis pectinacea has left across the world's sequence archives.
At a glance
DNA specimens25
Marker genes8
GenBank sequences10
eDNA detections13
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCCAA …
Eragrostis pectinacea voucher JAG 0704 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Eragrostis pectinacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 60 n = 30
Ploidypolyploid inferred
Chromosome records60–602n range60median60mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 603×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · book-ipcn65 — Gould 1965
CCDB · ipcn-api-dl — KERGUELEN, M. 1975. Les Gramineae (Poaceae) de la flore Francaise essai de mise au point taxonomique et nomenclaturale. Lejeunia 75: 1–343.
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
n 302×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · ipcn-api-dl — KERGUELEN, M. 1975. Les Gramineae (Poaceae) de la flore Francaise essai de mise au point taxonomique et nomenclaturale. Lejeunia 75: 1–343.
CCDB · book-ipcn67-71 — REEDER, J.R. 1968. Notes on Mexican grasses VIII. Miscellaneous chromosome numbers - 2. Bull. Torrey Bot. Club 95: 69-86.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type8 857 records
Wild obs. + sensor4 094
Museum / vouchered4 759
Other4
Origin
Native2
Introduced5
Range
Area of Occupancy AOO18 492 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy11% within 1 km
≤100 m 279≤1 km 70≤10 km 2 747>10 km 67
3 163 georeferenced · 931 without coordinates
Open the mapobservation + sensor4 094
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 563≤1 km 560≤10 km 916>10 km 133
2 172 georeferenced · 2 587 without coordinates
Open the institutions mapphysical evidence4 759
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions126 of 213 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 418 |
| Bronx, US | 368 |
| University of Stellenboschlocation not on record | 363 |
| International Salmonella Centre (W.H.O.)location not on record | 244 |
| Madison, US | 227 |
| Saint Louis, US | 213 |
| St. Paul, US | 195 |
| Ann Arbor, US | 180 |
| Bloomington, US | 146 |
| Davis, US | 125 |
| Austin, US | 120 |
| San Diego, US | 96 |
| Durango, MX | 87 |
| Riverside, US | 85 |
| WTUlocation not on record | 65 |
| Burlington, US | 63 |
| EL PASO, US | 55 |
| Québec, CA | 52 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 52 |
| Guasave, MX | 51 |
| Corvallis, US | 48 |
| Jena Microbial Resource Collectionlocation not on record | 43 |
| Vancouver, CA | 42 |
| University of New Hampshirelocation not on record | 42 |
| ASUlocation not on record | 39 |
| BIO-UNIPIlocation not on record | 34 |
| Flagstaff, US | 34 |
| Tampa, US | 33 |
| La Paz, MX | 32 |
| Pullman, US | 32 |
| Canadian Department of Agriculturelocation not on record | 31 |
| Montréal, CA | 27 |
| Mexico City, MX | 26 |
| Xiamen, CN | 25 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 25 |
| Vitoria, ES | 24 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 21 |
| Moscow, US | 21 |
| Mexico City, MX | 21 |
| Chadron, US | 19 |
| Torreón, MX | 16 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 15 |
| Portland, US | 15 |
| Zacatecas, MX | 15 |
| Northridge, US | 14 |
| Claremont, US | 14 |
| BISHlocation not on record | 14 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 13 |
| Aarhus, DK | 13 |
| GB | 13 |
| Pittsburg, US | 12 |
| Hermosillo, MX | 12 |
| Provo, US | 12 |
| Millersville, US | 12 |
| Boise, US | 11 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 11 |
| National Biodiversity Institute, Costa Ricalocation not on record | 11 |
| Little Rock, US | 11 |
| Kew, GB | 11 |
| Arcata, US | 10 |
| Denver, US | 10 |
| Honolulu, US | 10 |
| Toronto, CA | 10 |
| Fort Worth, US | 9 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| National Institute of Biological Resourceslocation not on record | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| Irvine, US | 9 |
| Los Angeles, US | 9 |
| Austin, US | 9 |
| Zürich, CH | 8 |
| Tuscaloosa, US | 8 |
| Albuquerque, US | 8 |
| Acadia Universitylocation not on record | 8 |
| Chicago, US | 8 |
| Auckland, NZ | 8 |
| Barcelona, ES | 7 |
| Santa Barbara, US | 7 |
| Durham, US | 7 |
| The University of Arizonalocation not on record | 7 |
| Dresden, DE | 7 |
| Montecillo, Texcoco, MX | 7 |
| Antiguo Cuscatlán, SV | 6 |
| Logan, US | 6 |
| Chapingo, MX | 6 |
| Córdoba, AR | 5 |
| Bureau of Land Management, Medford District Officelocation not on record | 5 |
| CASlocation not on record | 5 |
| Wlocation not on record | 5 |
| San Isidro, AR | 5 |
| Emporia, US | 5 |
| Phoenix, US | 5 |
| Ciudad de México, MX | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| San Luis Obispo, US | 4 |
| Berlin, DE | 4 |
| Miami, US | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Université de Bordeauxlocation not on record | 4 |
| USFSlocation not on record | 4 |
| Juriquilla, MX | 3 |
| Chapel Hill, US | 3 |
| Pretoria, ZA | 3 |
| Saint John, CA | 3 |
| Texas A&M Universitylocation not on record | 3 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 3 |
| BDBClocation not on record | 3 |
| Autlán de Navarro, MX | 3 |
| Fayetteville, US | 3 |
| LINUlocation not on record | 3 |
| Ciudad de México, MX | 3 |
| Ensenada, MX | 3 |
| New Mexico State Universitylocation not on record | 3 |
| Odawara, JP | 3 |
| University of Wisconsinlocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| CJBGlocation not on record | 3 |
| MeiseBGlocation not on record | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| College Park, US | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| BClocation not on record | 3 |
| Jackson, US | 3 |
| Texas Lutheran Universitylocation not on record | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Tall Timbers Research Stationlocation not on record | 3 |
| Angwin, US | 2 |
| Henderson, US | 2 |
| Santa Cruz, US | 2 |
| DULlocation not on record | 2 |
| UnBlocation not on record | 2 |
| Chicago, US | 2 |
| BAYLUlocation not on record | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| US | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| Universidad del Quindío (UniQuindío)location not on record | 2 |
| Lausanne, CH | 2 |
| Columbia, US | 2 |
| Victoria, CA | 2 |
| Clemson, US | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| Zürich, CH | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Fukushima Universitylocation not on record | 2 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| GAlocation not on record | 2 |
| Cenargenlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| VENlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Springfield, US | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| San Francisco, US | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| San Jose, US | 1 |
| Salzburg, AT | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Mérida, MX | 1 |
| AUAlocation not on record | 1 |
| MAlocation not on record | 1 |
| Brasília, BR | 1 |
| Salamanca, ES | 1 |
| León, NI | 1 |
| Fairfax, US | 1 |
| Durham, US | 1 |
| Denton, US | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| UMKClocation not on record | 1 |
| Turku, FI | 1 |
| Universität Göttingenlocation not on record | 1 |
| Oswego, US | 1 |
| Corrientes, AR | 1 |
| Mexico City, MX | 1 |
| Mlocation not on record | 1 |
| Bern, CH | 1 |
| Pamplona, ES | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Quito, EC | 1 |
| Calabar, NG | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| CIIDIRlocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Jefferson City, US | 1 |
| Morgantown, US | 1 |
| Morelia, MX | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| HCIBlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Durango, US | 1 |
| LDlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Brasília, BR | 1 |
| Bend, US | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Kirksville, US | 1 |
| Oskarshamn, SE | 1 |
| US | 1 |
| Caldwell, US | 1 |
| Görlitz, DE | 1 |
213 institutions · 4 538 of 4 759 vouchered records shown · 220 without an institution code
09Environmental DNA13 detections
Where the DNA of Eragrostis pectinacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map3 countries0
Riparian/Oak Woodland with Platanus racemosa…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.7 °C 15.9–21.0
Seasonal swing summer↔winter26.4 °C
Max temp (day)25.0 °C 21.8–26.8
Min temp (night)15.7 °C 10.9–17.3
Precipitation81.1 mm/mo 7.20–94.2
Air humidity59.3 % 48.8–60.8
Moisture balance-57.1 mm/mo -144–-30.3
Vapour deficit929 Pa 832–1,135
Wind speed3.10 m/s 1.60–3.60
Cloud cover37.5 % 22.9–42.4
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.