Eragrostis parviflora

(R.Br.) Trin. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Eragrostis

At a glance

Occurrence records4 250

Data sources9

Biological traits35

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Eragrostis parviflora's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 250 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF4 250 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Eragrostis parviflora is a widespread species of grass known as weeping lovegrass. Growing to metres tall, it may be found in many parts of Australia and New Caledonia. Leaves are strongly ribbed, hairless or with marginal hairs; the leaf blade may be flat or inrolled.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Fruit length0.5 mm

Leaf length200 mm

Leaf size378 mm²

Leaf width4.25 mm

Plant height0.9 m

Plant height max1.3 m

Plant height min0.3 m

Seed length0.5 mm

Seed mass0.071 mg

⚠ sources differ — TRY: 0.071 mg · AusTraits: 0.056 mg · GIFT: 0.147 mg

Seed mass max0.36 mg

Seed mass min0.03 mg

Life cycle & reproduction8

Dispersal typeself

Flowering timeyyyyyyyyyyyy

Life formannual or perennial

Life spanbiennial/shortlived perennial

⚠ sources differ — TRY: biennial/shortlived perennial · AusTraits: annual perennial · GIFT: annual

Pollination syndromeself+wind

Raunkiær life formtherophyte

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Habitat GIFTdense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)8.69 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis parviflora has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK863186.1 ↗663 bpAustralia

ACGT

ACCTGCGGAAGGATCATTGTCGTGACCCTTAACAAAACAGACCGCGAACATGTCATCCATGCTGCCGGGTGATGGGGCTTGCCTCGCCTC …

Eragrostis parviflora voucher Saarela 1657, Peterson, Soreng & Judziewicz (US) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS3★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type4 250 records

Wild obs. + sensor2 460

Museum / vouchered1 704

Other86

Origin

Native401

Introduced6

Range

Area of Occupancy AOO11 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 2 026≤1 km 173≤10 km 135>10 km 4

2 338 georeferenced · 122 without coordinates

Open the mapobservation + sensor2 460

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤100 m 316≤1 km 256≤10 km 737>10 km 247

1 556 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence1 704

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	370
Canberra, AU	321
Mount Annan, AU	298
Adelaide, AU	186
Museo Entomologico de Leonlocation not on record	145
NSW Dept of Planning, Industry and Environmentlocation not on record	84
Palmerston, AU	69
Armidale, AU	33
John T. Waterhouse Herbariumlocation not on record	23
Hobart, AU	17
NSW Office of Environment and Heritagelocation not on record	16
MeiseBGlocation not on record	15
Saint Louis, US	13
Universität Basel, Herbariumlocation not on record	13
Kensington, AU	10
Kew, GB	10
University of Stellenboschlocation not on record	7
Bern, CH	6
Smithfield, AU	6
Parkville, AU	6
Zürich, CH	4
Batemans Bay, AU	3
BISHlocation not on record	2
South Kensington, GB	2
La Trobe Universitylocation not on record	1
LDlocation not on record	1
Honolulu, US	1
Department of Land Resources Managementlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
IPA/SPlocation not on record	1
Nijmegen, NL	1
Zürich, CH	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Beijing, CN	1
James Cook Townsvillelocation not on record	1

35 institutions · 1 670 of 1 704 vouchered records shown · 33 without an institution code

09Environmental DNA1 detections

Where the DNA of Eragrostis parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eragrostis parviflora

At a glance

Sources9 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

Other traits1

At a glance

Record type4 250 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 250 records