Eragrostis minor
Host · speciesAt a glance
Occurrence records50 782
Data sources10
Biological traits58
DNA specimens59
eDNA detections24
Sources10 archives
Databases and archives Eragrostis minor's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility50 782 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics59 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources58 traits
Occurrence & distributionGBIF50 782 records
Environmental DNA1 datasets · 9 countries24 detections
DNA & barcodingBOLD · NCBI59 specimens
Genome at a glanceCCDB · GoaT716 Mbp
01Narrative
Eragrostis minor, la petite éragrostide ou l'Eragrostis faux-pâturin, est une espèce de plantes monocotylédones de la famille des Poaceae, originaire du bassin méditerranéen, devenue subcosmopolite. C'est une petite plante herbacée annuelle, de 10 à 40 cm de haut, qui se rencontre fréquemment sur les bords de route, dans les rues et places pavées, mais aussi sur le pentes des montagnes et dans les prairies. On la trouve dans toutes les régions tropicales, subtropicales et tempérées du monde.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology13
Fruit length0.75 mm
Leaf length60 mm
Leaf mass3.01 mg
Leaf size138 mm²
⚠ sources differ — TRY: 138 mm² · AusTraits: 158 mm² · LEDA: 97.99 mm² · GIFT: 118 mm²
Leaf width6 mm
Plant height0.263 m
⚠ sources differ — GIFT: 0.263 m · AusTraits: 0.6 m · LEDA: 0.125 m · TRY: 0.163 m
Plant height generative0.25 m
Plant height max0.6 m
Plant height min0.05 m
Seed length0.65 mm
Seed mass0.083 mg
⚠ sources differ — TRY: 0.083 mg · LEDA: 0.092 mg · GIFT: 0.085 mg
Seed mass max0.1 mg
Seed mass min0.07 mg
Life cycle & reproduction14
Deciduousnessdeciduous
Dispersal typeself
⚠ sources differ — AusTraits: barochory · LEDA: agochor · GIFT: anemochorous
Flowering endSep
Flowering startAug
Life formannual or perennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: annual · LEDA: summer annuals · GIFT: annual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number460 570
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max2 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid
Habitat GIFTopen roadsides
Leaf compoundnesssimple
Leaf formlanceolate
Leaf shapelinear
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio13.66 g/g
Leaf c441 mg/g
Leaf dry-matter content (LDMC)304 mg/g
⚠ sources differ — TRY: 304 mg/g · LEDA: 221 mg/g
Leaf n17.28 mg/g
Leaf p2.09 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Seed longevity index1
Specific leaf area (SLA)19.98 mm²/mg
⚠ sources differ — TRY: 19.98 mm²/mg · LEDA: 37.2 mm²/mg · GIFT: 35.87 mm²/mg
Other traits5
Diaspore typeone-seeded generative dispersule
Leaf marginentire
Leaf spinesno
Leaf thornsno
Seeds per fruit101-1000
05DNA & barcoding59 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis minor has left across the world's sequence archives.
At a glance
DNA specimens59
Marker genes15
GenBank sequences10
eDNA detections24
Countries10
The DNA barcodea real sequence read deposited for this species
CCCAGACTTCCGTATGGAGGGCTGGAGCCGCAAAAGAACCCACGGCGCCGATGGCGTCAAGGAACACTAATATTGCCTTGCCCAAGGTCG …
Eragrostis minor voucher KS23 HER0256 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★matK-like★rbcL1★rbcL-like★rbcLa★trnL-F★ITS8★ITS2atpF-atpHcp-trnL-intronpsbK-psbIrpoBrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Eragrostis minor carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size715 536 734 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Eragrostis minor0.72 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 40 n = 20
Ploidy4× tetraploid · measured
Chromosome records20–802n range40median40mode29records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4022×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · fl-europaea — Majovsky et al.,
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-indian_vol2 — Tateoka, T. 1954; Swami, U.B.S. 1963 ; Mehra, P.N. et al. 1968 ; Fernandes, A. & Queiros, M. 1969
CCDB · book-indian_vol2 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)
CCDB · eflora
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P. & Rudyka, E. G. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1978). Chromosome numbers of some grasses (Poaceae) of the U.S.S.R. Flora II. Bot. Žurn. 63: 1247-1257.
CCDB · CromoCat 2015 — Tateoka, T. (1955a). Karyotaxonomic studies in Poaceae. II. Natl. Inst. Genet. (Japan), Ann. Rep. 5: 68-69.
CCDB · iapt — IAPT/IOPB Chromosome Data 20
2n 304×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl
CCDB · book-indian_vol2 — Mulay, B.N. & Jagdisan, D. 1955 ; However (Swami, U.B.S. 1963)
CCDB · CromoCat 2015 — Magulaev, A. Y. (1984). Cytotaxonomix study in some flowering plants of the North Caucasus. Bot. Žurn. 69: 511-517.
2n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl
2n 601×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Reeder, J.R. 1977
2n 801×CCDB · fl-europaea
CCDB · fl-europaea — Fernandes & Queiros,
n 206×CCDB · ipcn-api-dl · CCDB · Cave1963 · CCDB · CromoCat 2015 +1
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · Cave1963 — Swami 1963
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · iapt — IAPT/IOPB Chromosome Data 29
n 304×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 152–154.
CCDB · book-ipcn75-78 — Reeder 1977
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1986). SOCGI plant chromosome number reports -- IV J. Cytol. Genet. 21: 152-154
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
n 403×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 101×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
n 181×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 18
n 221×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type50 782 records
Wild obs. + sensor44 184
Museum / vouchered6 286
Cultivated / captive4
Other308
Origin
Native47
Introduced662
Range
Area of Occupancy AOO84 076 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy28% within 1 km
≤100 m 6 876≤1 km 3 234≤10 km 25 789>10 km 223
36 122 georeferenced · 8 062 without coordinates
Open the mapobservation + sensor44 184
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 627≤1 km 782≤10 km 1 351>10 km 111
2 871 georeferenced · 3 415 without coordinates
Open the institutions mapphysical evidence6 286
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 3 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions162 of 318 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 401 |
| Uniwersytet Wrocławskilocation not on record | 221 |
| Beijing, CN | 183 |
| Odawara, JP | 179 |
| Bern, CH | 177 |
| Adelaide, AU | 161 |
| Provincia di Livornolocation not on record | 155 |
| MeiseBGlocation not on record | 152 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 137 |
| Berlin, DE | 135 |
| BFLlocation not on record | 120 |
| BIO-UNIPIlocation not on record | 104 |
| Brisbane, AU | 100 |
| Zürich, CH | 95 |
| LDlocation not on record | 94 |
| Adam Mickiewicz University in Poznańlocation not on record | 88 |
| Nagano City, JP | 83 |
| Salzburg, AT | 83 |
| Chongqing Museumlocation not on record | 73 |
| Madison, US | 72 |
| Uniwersytet Warszawskilocation not on record | 72 |
| Brussel, BE | 66 |
| Canberra, AU | 64 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 64 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 63 |
| BRNUlocation not on record | 62 |
| GMBAlocation not on record | 58 |
| Palmerston, AU | 58 |
| Görlitz, DE | 57 |
| Mlocation not on record | 48 |
| Saint Louis, US | 48 |
| Kew, GB | 48 |
| Ann Arbor, US | 48 |
| Bronx, US | 47 |
| GJOlocation not on record | 47 |
| Kawasaki Shi Tama Ku, JP | 42 |
| Universität Basel, Herbariumlocation not on record | 41 |
| Museo Entomologico de Leonlocation not on record | 38 |
| Zürich, CH | 38 |
| Kochi, JP | 37 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 36 |
| Tomioka, JP | 36 |
| Dresden, DE | 35 |
| University of Stellenboschlocation not on record | 34 |
| Wuzhou, CN | 33 |
| Denver, US | 31 |
| SLU Artdatabankenlocation not on record | 30 |
| Mount Annan, AU | 28 |
| Kunming, CN | 27 |
| Burlington, US | 26 |
| Toyama, JP | 26 |
| Chadron, US | 26 |
| Wlocation not on record | 25 |
| Irkutsk State Universitylocation not on record | 25 |
| Montréal, CA | 24 |
| Hobart, AU | 24 |
| Shinshu Universitylocation not on record | 24 |
| BClocation not on record | 24 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 23 |
| Vancouver, CA | 23 |
| Jiangxi College of Educationlocation not on record | 22 |
| Bando, JP | 22 |
| MAlocation not on record | 21 |
| Salamanca, ES | 21 |
| NSMKlocation not on record | 21 |
| Tokushima, JP | 20 |
| CJBGlocation not on record | 20 |
| KMCClocation not on record | 19 |
| IDElocation not on record | 19 |
| Tsukuba, JP | 19 |
| International Salmonella Centre (W.H.O.)location not on record | 18 |
| Oskarshamn, SE | 18 |
| Nijmegen, NL | 18 |
| Kensington, AU | 17 |
| WTUlocation not on record | 17 |
| Badajoz, ES | 16 |
| Bloomington, US | 16 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 16 |
| Barcelona, ES | 15 |
| Uniwersytet Jagiellońskilocation not on record | 15 |
| Sagamihara, JP | 15 |
| Hiratsuka City Museumlocation not on record | 15 |
| Urumqi, CN | 15 |
| Corvallis, US | 14 |
| Moscow, US | 14 |
| Philadelphia, US | 14 |
| Davis, US | 14 |
| Missoula, US | 14 |
| Toronto, CA | 13 |
| J.F.Oberlin Universitylocation not on record | 13 |
| BDBClocation not on record | 13 |
| Olocation not on record | 12 |
| National Institute of Biological Resourceslocation not on record | 12 |
| SZUlocation not on record | 12 |
| Frauenfeld, CH | 12 |
| Frankfurt am Main | 12 |
| Parthenon Tama History Museumlocation not on record | 12 |
| Fukushima Universitylocation not on record | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| Beijing, CN | 11 |
| Jena Microbial Resource Collectionlocation not on record | 10 |
| Akita Prefectural Museumlocation not on record | 10 |
| Paris, FR | 10 |
| JP | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Tampa, US | 9 |
| DBF-NHMDlocation not on record | 9 |
| València, ES | 9 |
| GZUlocation not on record | 9 |
| PRClocation not on record | 8 |
| Tuscaloosa, US | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Green Bay, US | 8 |
| WNNUlocation not on record | 8 |
| San Diego, US | 8 |
| PrivatHerblocation not on record | 8 |
| Vitoria, ES | 8 |
| Otaru, JP | 8 |
| Little Rock, US | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Nishihara, JP | 7 |
| Universität Tübingenlocation not on record | 7 |
| St. Paul, US | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Logan, US | 7 |
| University of New Hampshirelocation not on record | 7 |
| Columbia, US | 7 |
| Provo, US | 6 |
| CICYTEXlocation not on record | 6 |
| Auckland, NZ | 6 |
| Osaka, JP | 6 |
| H-Schuhwlocation not on record | 6 |
| Boise, US | 6 |
| US | 6 |
| Riverside, US | 6 |
| Nishihara, JP | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| 盐城国家级珍禽自然保护区location not on record | 6 |
| James Cook Townsvillelocation not on record | 6 |
| Dekalb, US | 5 |
| Pretoria, ZA | 5 |
| Bozeman, US | 5 |
| Edinburgh, GB | 5 |
| Jackson, US | 5 |
| South Kensington, GB | 5 |
| Acadia Universitylocation not on record | 5 |
| Inner Mongolia Universitylocation not on record | 5 |
| Tianjin Natural History Museumlocation not on record | 5 |
| Pullman, US | 5 |
| Karlsruhe, DE | 5 |
| Claremont, US | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Chengdu, CN | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Granada, ES | 4 |
| Saint John, CA | 4 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 4 |
| Flagstaff, US | 4 |
| UFESlocation not on record | 4 |
| Coimbra, PT | 4 |
| New Brunswick, US | 4 |
| Sendai, JP | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| Fulda, DE | 4 |
| Federal University of Espírito Santolocation not on record | 4 |
| Ciudad Autónoma de Buenos Aires, AR | 4 |
| BAYLUlocation not on record | 4 |
| Museum of the Rockieslocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| Bergen, NO | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Cenargenlocation not on record | 3 |
| Christchurch, NZ | 3 |
| LfUlocation not on record | 3 |
| Taipei, TW | 3 |
| Porrentruy, CH | 3 |
| Trondheim, NO | 3 |
| H-AkrKGlocation not on record | 3 |
| Chengdu, CN | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| KOMlocation not on record | 3 |
| Elocation not on record | 3 |
| Helsinki, FI | 3 |
| Taipei, TW | 3 |
| Wellington, NZ | 3 |
| Guangzhou, CN | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Brasília, BR | 3 |
| Victoria, CA | 3 |
| Hazara Universitylocation not on record | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Bratislava, SK | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| Philadelphia, US | 3 |
| Bend, US | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| New Haven, US | 2 |
| Blumenau, BR | 2 |
| Smithfield, AU | 2 |
| ASUlocation not on record | 2 |
| TAIElocation not on record | 2 |
| H-Adlerlocation not on record | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Edmonton, CA | 2 |
| Kyoto Universitylocation not on record | 2 |
| Pittsburg, US | 2 |
| San Isidro, AR | 2 |
| Whitehorse, CA | 2 |
| Uppsala, SE | 2 |
| CASlocation not on record | 2 |
| Glocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| GB | 2 |
| Lincoln, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Austin, US | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Conservatoire Botanique National de Mascarinlocation not on record | 2 |
| Chapel Hill, US | 2 |
| Madrid, ES | 2 |
| H-Dueringlocation not on record | 2 |
| Plocation not on record | 2 |
| Mexico City, MX | 2 |
| AUAlocation not on record | 2 |
| Zhejiang Universitylocation not on record | 2 |
| Sanda, JP | 2 |
| EL PASO, US | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| MCNAMlocation not on record | 2 |
| Universität Göttingenlocation not on record | 2 |
| Awka, NG | 2 |
| CJBNlocation not on record | 2 |
| Millersville, US | 2 |
| Yunnan Universitylocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Tilburg, NL | 2 |
| Hebei Normal Universitylocation not on record | 2 |
| Morgantown, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Santa Maria, BR | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Pamplona, ES | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Tartu, EE | 1 |
| Lausanne, CH | 1 |
| Lanzhou, CN | 1 |
| Henderson, US | 1 |
| Turku, FI | 1 |
| Peking Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Pondicherry, IN | 1 |
| San Luis Obispo, US | 1 |
| Changsha, CN | 1 |
| Baroda, IN | 1 |
| TROMlocation not on record | 1 |
| Fribourg, CH | 1 |
| Angwin, US | 1 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 1 |
| Bourges, FR | 1 |
| Córdoba, ES | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Emporia, US | 1 |
| Clarksville, US | 1 |
| University of Central Missourilocation not on record | 1 |
| Clemson, US | 1 |
| Columbus State Universitylocation not on record | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Taipei, TW | 1 |
| Namur, BE | 1 |
| Arcata, US | 1 |
| Spearfish, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Department of Land Resources Managementlocation not on record | 1 |
| Oswego, US | 1 |
| Córdoba, AR | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Brookings, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Fayetteville, US | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Williamsburg, US | 1 |
| H-Meierottlocation not on record | 1 |
| Fort Worth, US | 1 |
| Herb. BBGlocation not on record | 1 |
| NoColllocation not on record | 1 |
| La Paz, MX | 1 |
| München, DE | 1 |
| Dehra Dun, IN | 1 |
| GAlocation not on record | 1 |
| University of Salzburglocation not on record | 1 |
| Göteborg, SE | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| KMNlocation not on record | 1 |
| Caldwell, US | 1 |
| The Cattle Museumlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Conway, US | 1 |
318 institutions · 5 738 of 6 286 vouchered records shown · 478 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Eragrostis minor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map9 countries0
Granite outcropGardenruderal dry sites on road
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.5 °C 12.5–21.1
Seasonal swing summer↔winter17.4 °C
Max temp (day)21.0 °C 18.4–25.7
Min temp (night)11.8 °C 8.20–16.6
Precipitation79.6 mm/mo 42.3–135
Air humidity58.6 % 50.4–62.6
Moisture balance-37.4 mm/mo -97.7–45.5
Vapour deficit804 Pa 652–1,101
Wind speed3.30 m/s 2.40–5.80
Cloud cover38.5 % 25.7–46.7
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.