Eragrostis mexicana
(Hornem.) Link · speciesAt a glance
Occurrence records2 806
Data sources10
Biological traits41
DNA specimens14
eDNA detections7
Sources10 archives
Databases and archives Eragrostis mexicana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 806 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics14 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Occurrence & distributionGBIF2 806 records
Environmental DNA1 datasets · 3 countries7 detections
DNA & barcodingBOLD · NCBI14 specimens
Genome at a glanceCCDB2n = 60
01Narrative
Eragrostis mexicana é uma espécie de planta com flor pertencente à família Poaceae. A autoridade científica da espécie é (Hornem.) Link, tendo sido publicada em Hortus Regius Botanicus Berolinensis 1: 190. 1827.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology13
Fruit length0.6 mm
Leaf length250 mm
Leaf length max2 mm
Leaf size682 mm²
Leaf width6.75 mm
Leaf width max10 mm
Leaf width min2 mm
Plant height0.925 m
⚠ sources differ — AusTraits: 0.925 m · TRY: 0.242 m
Plant height max1.2 m
Plant height min0.12 m
Seed mass0.09 mg
⚠ sources differ — TRY: 0.09 mg · GIFT: 0.109 mg
Seed mass max0.18 mg
Seed mass min0.062 mg
Life cycle & reproduction8
Deciduousnessdeciduous
Dispersal typeself
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Pollination syndromewind
Raunkiær life formtherophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Leaf compoundnesssimple
Leaf shapelinear
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio18.55 g/g
Leaf c428 mg/g
Leaf dry-matter content (LDMC)276 mg/g
Leaf n23.15 mg/g
Leaf p0.797 mg/g
Photosynthetic pathwayC4
Specific leaf area (SLA)41.62 mm²/mg
05DNA & barcoding14 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis mexicana has left across the world's sequence archives.
At a glance
DNA specimens14
Marker genes5
GenBank sequences10
eDNA detections7
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCCAA …
Eragrostis mexicana voucher CCDB-18344-A5 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Eragrostis mexicana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 60 n = 30
Ploidypolyploid inferred
Chromosome records56–602n range60median60mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 606×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +2
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · book-ipcn66 — Gould 1966
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
CCDB · book-atlas-flowering-plants — 1928
CCDB · CromoCat 2015 — Pohl, R. W. & G. Davidse. (1971). Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
2n 561×CCDB · book-ipcn66
CCDB · book-ipcn66 — Singh & Godward 1960
n 303×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Ward, D. E. & R. Spellenberg. 1988. Chromosome counts of angiosperms from New Mexico and adjacent areas. Phytologia 64: 390–398.
CCDB · book-ipcn67-71 — REEDER, J.R. 1968. Notes on Mexican grasses VIII. Miscellaneous chromosome numbers - 2. Bull. Torrey Bot. Club 95: 69-86.
CCDB · book-ipcn75-78 — Davidse & Pohl 1978
n 281×CCDB · book-ipcn66
CCDB · book-ipcn66 — Singh & Godward 1960
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 806 records
Wild obs. + sensor317
Museum / vouchered2 455
Other34
Origin
Native18
Introduced230
Range
Area of Occupancy AOO6 976 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 67≤1 km 48≤10 km 167>10 km 2
284 georeferenced · 33 without coordinates
Open the mapobservation + sensor317
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy70% within 1 km
≤100 m 701≤1 km 165≤10 km 354>10 km 25
1 245 georeferenced · 1 210 without coordinates
Open the institutions mapphysical evidence2 455
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions101 of 161 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| University of Stellenboschlocation not on record | 408 |
| Durango, MX | 174 |
| Guasave, MX | 108 |
| Mexico City, MX | 96 |
| Austin, US | 94 |
| Mount Annan, AU | 90 |
| Xiamen, CN | 65 |
| ASUlocation not on record | 65 |
| Flagstaff, US | 60 |
| Saint Louis, US | 55 |
| Museo Entomologico de Leonlocation not on record | 51 |
| Kew, GB | 51 |
| Zacatecas, MX | 51 |
| Canberra, AU | 44 |
| Aarhus, DK | 42 |
| Santa Barbara, US | 41 |
| Bronx, US | 40 |
| Brisbane, AU | 39 |
| Riverside, US | 36 |
| Juriquilla, MX | 35 |
| Chapingo, MX | 30 |
| National Biodiversity Institute, Costa Ricalocation not on record | 28 |
| BDBClocation not on record | 27 |
| Albuquerque, US | 26 |
| Mexico City, MX | 25 |
| Ciudad de México, MX | 23 |
| Autlán de Navarro, MX | 22 |
| Phoenix, US | 22 |
| Córdoba, AR | 20 |
| Ann Arbor, US | 19 |
| EL PASO, US | 18 |
| Austin, US | 18 |
| Ciudad de México, MX | 17 |
| Logan, US | 15 |
| Zürich, CH | 15 |
| Tampa, US | 14 |
| MeiseBGlocation not on record | 14 |
| Puebla, MX | 13 |
| San Luis Obispo, US | 13 |
| Adelaide, AU | 13 |
| USFSlocation not on record | 12 |
| Puerto Ayora, EC | 11 |
| Ixtacuixtla de Mariano Matamoros, MX | 11 |
| La Paz, MX | 10 |
| Bern, CH | 10 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 9 |
| LDlocation not on record | 9 |
| Antiguo Cuscatlán, SV | 9 |
| Universität Basel, Herbariumlocation not on record | 9 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 8 |
| San Luis Potosí, MX | 7 |
| Toluca, MX | 7 |
| Auckland, NZ | 7 |
| San Diego, US | 7 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 7 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| San Angelo, US | 6 |
| Brussel, BE | 6 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 5 |
| Palmerston, AU | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Anchorage, US | 5 |
| Mérida, MX | 5 |
| Carter County Museumlocation not on record | 5 |
| CIIDIRlocation not on record | 4 |
| South Kensington, GB | 4 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Santa Cruz, US | 4 |
| Chapel Hill, US | 4 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 4 |
| Claremont, US | 4 |
| Zürich, CH | 4 |
| Texas A&M Universitylocation not on record | 4 |
| US | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Tapachula, MX | 3 |
| Loja, EC | 3 |
| DanBIFlocation not on record | 3 |
| NO DISPONIBLElocation not on record | 3 |
| Giardini Botanici Hanburylocation not on record | 3 |
| Montecillo, Texcoco, MX | 3 |
| New Mexico State Universitylocation not on record | 3 |
| Davis, US | 3 |
| TLAXlocation not on record | 3 |
| PRClocation not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| BAYLUlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Berlin, DE | 3 |
| Ciudad Juárez, MX | 3 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 3 |
| UTPLlocation not on record | 2 |
| Stockholm, SE | 2 |
| Moscow, US | 2 |
| Bend, US | 2 |
| The University of Arizonalocation not on record | 2 |
| Brasília, BR | 2 |
| Brasília, BR | 2 |
| San José, CR | 2 |
| Barcelona, ES | 2 |
| James Cook Townsvillelocation not on record | 2 |
| Hobart, AU | 2 |
| MAlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Chaguaramas, TT | 2 |
| BClocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| Armidale, AU | 2 |
| Tempe, US | 2 |
| Lausanne, CH | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Lubbock, US | 2 |
| Uppsala, SE | 2 |
| Chicago, US | 2 |
| Pullman, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Linares, MX | 1 |
| Madrid, ES | 1 |
| University of New Hampshirelocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Christchurch, NZ | 1 |
| San Francisco, US | 1 |
| Oskarshamn, SE | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 1 |
| Fort Worth, US | 1 |
| OTSlocation not on record | 1 |
| Provo, US | 1 |
| Wellington, NZ | 1 |
| CASlocation not on record | 1 |
| Llocation not on record | 1 |
| Mexico City, MX | 1 |
| Wuzhou, CN | 1 |
| Chadron, US | 1 |
| UFSMlocation not on record | 1 |
| Culiacán, MX | 1 |
| Kensington, AU | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| Londrina, BR | 1 |
| Morelia, MX | 1 |
| Smithfield, AU | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Valparaíso, CL | 1 |
| Plocation not on record | 1 |
| Quito, EC | 1 |
| La Paz, BO | 1 |
| Wollongong, AU | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Columbia, US | 1 |
| Irvine, US | 1 |
| Philadelphia, US | 1 |
| Buenos Aires, AR | 1 |
| Tuxtla Gutiérrez, MX | 1 |
161 institutions · 2 408 of 2 455 vouchered records shown · 46 without an institution code
09Environmental DNA7 detections
Where the DNA of Eragrostis mexicana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map3 countries0
Phenology=FFL
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.5 °C 13.1–22.8
Seasonal swing summer↔winter9.50 °C
Max temp (day)19.7 °C 18.1–27.1
Min temp (night)14.1 °C 8.20–19.8
Precipitation47.6 mm/mo 19.9–117
Air humidity60.4 % 58.0–69.3
Moisture balance0.7 mm/mo -87.9–11.0
Vapour deficit629 Pa 612–962
Wind speed1.90 m/s 1.20–2.40
Cloud cover36.5 % 34.9–61.9
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.