Eragrostis hypnoides
(Lam.) Britton, Sterns & Poggenb. · speciesAt a glance
Occurrence records2 745
Data sources12
Biological traits91
DNA specimens2
eDNA detections1
Sources12 archives
Databases and archives Eragrostis hypnoides's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 745 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics2 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources91 traits
Occurrence & distributionGBIF2 745 records
Environmental DNA1 datasets · 1 countries1 detections
DNA & barcodingBOLD · NCBI2 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Eragrostis hypnoides is a species of grass known by the common name teal lovegrass. It is native to the Americas from Canada to Argentina. It is found in moist areas near water in substrates of sand or mud.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height0.09 m
Seed mass0.05 mg
⚠ sources differ — TRY: 0.05 mg · GIFT: 0.066 mg
Seed mass max0.08 mg
Seed mass min0.025 mg
Life cycle & reproduction23
Bloom periodSummer
Coppice potentialNo
Flower colourgreen
Flower conspicuousNo
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDASlow
Life formannual
Life spanannual
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed spread rateRapid
Seedling vigorMedium
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment27
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colouryellow
Growth formherb
Growth form USDABunch
Habitat GIFTCampo de Várzea
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Root depth min6 in
Shape and orientationProstrate
Small grainNo
Woodinessnon-woody
Physiology & chemistry18
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min110 days
Moisture useHigh
Nitrogen fixation levelNone
Precipitation max60 in
Precipitation min16 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max8.5 pH
Soil pH min4.5 pH
Temperature min-38 °F
Uses & economy14
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound5 669 906 per lb
ToxicityNone
Veneer productNo
Other traits4
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding2 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis hypnoides has left across the world's sequence archives.
At a glance
DNA specimens2
Marker genes5
GenBank sequences5
eDNA detections1
Countries1
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGACGCCATCTGGCTGAGGGCACGTCTGCCTGGGCGTCACGCCGA …
Eragrostis hypnoides voucher CCDB-18344-H6 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Eragrostis hypnoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Davidse, G. 1981. Chromosome numbers of miscellaneous angiosperms. Ann. Missouri Bot. Gard. 68: 222–223.
n 101×CCDB · book-ipcn72
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers, meiotic behavior, and notes on some grasses from Central America and the West Indies. Canad. J. Bot. 50: 1441-1452.
n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Davidse, G. 1981. Chromosome numbers of miscellaneous angiosperms. Ann. Missouri Bot. Gard. 68: 222–223.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 745 records
Wild obs. + sensor206
Museum / vouchered2 539
Origin
Native120
Range
Area of Occupancy AOO7 696 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy73% within 1 km
≤100 m 118≤1 km 9≤10 km 2>10 km 44
173 georeferenced · 33 without coordinates
Open the mapobservation + sensor206
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 134≤1 km 363≤10 km 476>10 km 85
1 058 georeferenced · 1 481 without coordinates
Open the institutions mapphysical evidence2 539
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions137 of 228 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 180 |
| Saint Louis, US | 163 |
| International Salmonella Centre (W.H.O.)location not on record | 141 |
| St. Paul, US | 132 |
| Chongqing Museumlocation not on record | 121 |
| Bloomington, US | 96 |
| Philadelphia, US | 95 |
| Wuzhou, CN | 92 |
| Madison, US | 83 |
| University of Stellenboschlocation not on record | 73 |
| San Isidro, AR | 43 |
| UNIVASFlocation not on record | 35 |
| Ann Arbor, US | 33 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 33 |
| Logan, US | 32 |
| WTUlocation not on record | 32 |
| Burlington, US | 32 |
| Tampa, US | 30 |
| Davis, US | 30 |
| Durango, MX | 27 |
| Montréal, CA | 25 |
| Pullman, US | 25 |
| Corvallis, US | 24 |
| Jackson, US | 24 |
| Allentown, US | 22 |
| Corrientes, AR | 20 |
| Claremont, US | 20 |
| Kew, GB | 19 |
| Fort Worth, US | 19 |
| Fayetteville, US | 17 |
| Córdoba, AR | 15 |
| Williamsburg, US | 15 |
| St. Augustine, TT | 14 |
| New Haven, US | 14 |
| Moscow, US | 14 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 13 |
| UFMSlocation not on record | 13 |
| Jena Microbial Resource Collectionlocation not on record | 12 |
| Mississippi State, US | 12 |
| US | 12 |
| Missoula, US | 11 |
| Cenargenlocation not on record | 10 |
| Austin, US | 10 |
| Green Bay, US | 10 |
| Henderson, US | 9 |
| Salvador, BR | 9 |
| Riverside, US | 8 |
| Brasília, BR | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Tuscaloosa, US | 8 |
| National Biodiversity Institute, Costa Ricalocation not on record | 8 |
| Portland, US | 8 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 8 |
| ASUlocation not on record | 8 |
| Millersville, US | 7 |
| Québec, CA | 7 |
| Xiamen, CN | 7 |
| Chadron, US | 7 |
| BAYLUlocation not on record | 7 |
| Brasília, BR | 7 |
| Chapel Hill, US | 7 |
| Chicago, US | 6 |
| Université Lavallocation not on record | 6 |
| Davenport, US | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 6 |
| GB | 6 |
| Canadian Department of Agriculturelocation not on record | 6 |
| Ciudad Autónoma de Buenos Aires, AR | 6 |
| Université de Bordeauxlocation not on record | 6 |
| Castelar, AR | 6 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 6 |
| Pittsburg, US | 6 |
| Chicago, US | 5 |
| Santa Barbara, US | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| Columbia, US | 5 |
| Toronto, CA | 5 |
| San Diego, US | 5 |
| Edmonton, CA | 5 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 5 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 5 |
| San Luis Obispo, US | 5 |
| GAlocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| UFBAlocation not on record | 5 |
| University of New Hampshirelocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Laboratorio de Ictiologialocation not on record | 5 |
| BAlocation not on record | 5 |
| San Angelo, US | 5 |
| Dekalb, US | 5 |
| UFSMlocation not on record | 5 |
| Lincoln, US | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| UFERSAlocation not on record | 4 |
| Flagstaff, US | 4 |
| Morgantown, US | 4 |
| Caldwell, US | 4 |
| Bozeman, US | 4 |
| Knoxville, US | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Fairfax, US | 4 |
| Little Rock, US | 4 |
| Boise, US | 4 |
| CEPLAClocation not on record | 4 |
| CASlocation not on record | 3 |
| Arcata, US | 3 |
| Plocation not on record | 3 |
| Denver, US | 3 |
| PRClocation not on record | 3 |
| Feira de Santana, BR | 3 |
| Mérida, MX | 3 |
| AUAlocation not on record | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| Miami, US | 3 |
| Norfolk, US | 3 |
| Albuquerque, US | 3 |
| Altos de Pipe, VE | 3 |
| Austin, US | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Antiguo Cuscatlán, SV | 3 |
| South Kensington, GB | 3 |
| Waverly, US | 3 |
| Cambridge, US | 3 |
| Valdosta State Universitylocation not on record | 3 |
| León, NI | 3 |
| Philadelphia, US | 3 |
| College Park, US | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Pocatello, US | 3 |
| Berlin, DE | 3 |
| Oskarshamn, SE | 2 |
| University of Wisconsinlocation not on record | 2 |
| Paleontological Collectionlocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| UFPElocation not on record | 2 |
| EL PASO, US | 2 |
| CPATSAlocation not on record | 2 |
| Auckland, NZ | 2 |
| CJBGlocation not on record | 2 |
| Fortaleza, BR | 2 |
| Ciudad de México, MX | 2 |
| MEXUlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Los Angeles, US | 2 |
| Mexico City, MX | 2 |
| Blumenau, BR | 2 |
| UnBlocation not on record | 2 |
| Londrina, BR | 2 |
| University of Winnipeglocation not on record | 2 |
| Phoenix, US | 2 |
| Wlocation not on record | 2 |
| Dresden, DE | 2 |
| UEPAlocation not on record | 2 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Ciudad de México, MX | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Saint John, CA | 1 |
| Portland, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| Moscow State Universitylocation not on record | 1 |
| Dover, US | 1 |
| Torreón, MX | 1 |
| Autlán de Navarro, MX | 1 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 1 |
| Aarhus, DK | 1 |
| Provo, US | 1 |
| Whitehorse, CA | 1 |
| University of Zhejianglocation not on record | 1 |
| Beijing, CN | 1 |
| Masindi, UG | 1 |
| Northridge, US | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Emporia, US | 1 |
| UEMlocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Montpellier, FR | 1 |
| Santa Cruz, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Clemson, US | 1 |
| Stephenville, US | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| La Paz, BO | 1 |
| Springfield, US | 1 |
| VENlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| LINUlocation not on record | 1 |
| Conway, US | 1 |
| San José, CR | 1 |
| Cochabamba, BO | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Hermosillo, MX | 1 |
| NO DISPONIBLElocation not on record | 1 |
| San Jose, US | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Clocation not on record | 1 |
| MAlocation not on record | 1 |
| LGlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Elikins, US | 1 |
| Orem, US | 1 |
| Angwin, US | 1 |
| Grand Junction, US | 1 |
| Turku, FI | 1 |
| Trois-Rivières, CA | 1 |
| Universidad Nacional del Litorallocation not on record | 1 |
| Long Beach, US | 1 |
| FUVATESlocation not on record | 1 |
| Madrid, ES | 1 |
| Due West, US | 1 |
| Staten Island, US | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| UNESP-ISlocation not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Universidad de los Andes (UniAndes)location not on record | 1 |
| Kirksville, US | 1 |
228 institutions · 2 448 of 2 539 vouchered records shown · 91 without an institution code
09Environmental DNA1 detections
Where the DNA of Eragrostis hypnoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 16.9–16.9
Seasonal swing summer↔winter26.2 °C
Max temp (day)21.8 °C
Min temp (night)13.6 °C
Precipitation98.7 mm/mo
Air humidity59.6 %
Moisture balance-8.20 mm/mo
Vapour deficit773 Pa
Wind speed3.90 m/s
Cloud cover45.6 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.