Eragrostis dielsii

Pilg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Eragrostis

At a glance

Occurrence records5 064

Data sources7

Biological traits36

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Eragrostis dielsii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 064 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Occurrence & distributionGBIF5 064 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Eragrostis dielsii, atau yang lebih dikenal dengan sebutan mallee lovegrass, adalah sebuah spesies tumbuhan yang merupakan endemik di Australia. Spesies tersebut mula-mula dipublikasikan pada 1904 oleh Robert Knud Friedrich Pilger

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length0.9 mm

Leaf length80 mm

Leaf size90 mm²

Leaf width3.5 mm

Plant height0.4 m

⚠ sources differ — AusTraits: 0.4 m · TRY: 0.3 m

Plant height max0.6 m

Plant height min0.03 m

Seed length0.97 mm

Seed mass0.059 mg

⚠ sources differ — TRY: 0.059 mg · AusTraits: 0.054 mg · GIFT: 0.053 mg

Seed mass max0.068 mg

Seed mass min0.04 mg

Seed width0.48 mm

Life cycle & reproduction8

Dispersal typeself

⚠ sources differ — AusTraits: barochory · GIFT: unspecialized

Flowering timeyyyyyyyyyyyy

Life formannual or perennial

Life spanbiennial/shortlived perennial

⚠ sources differ — TRY: biennial/shortlived perennial · AusTraits: annual short_lived_perennial · GIFT: annual

Pollination syndromeself+wind

Raunkiær life formtherophyte

Resprouting capacityfire_killed resprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecaryopsis

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Leaf shapefiliform

Mycorrhiza type0.0000000000901

Woodinessnon-woody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

Specific leaf area (SLA)5.7 mm²/mg

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis dielsii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF019834.1 ↗597 bp

ACGT

TCGTGACCCTGACCAAAATAGACCGCGAACATGTCATCCATGCCGTCGGGTGATGGGGCTTGCCTCGCCTCCCGACTTAGGCCCCAGACT …

Eragrostis dielsii internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

08Occurrence & distribution

Record type5 064 records

Wild obs. + sensor2 811

Museum / vouchered2 228

Cultivated / captive2

Other23

Origin

Native1 060

Range

Area of Occupancy AOO13 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 2 088≤1 km 238≤10 km 167>10 km 8

2 501 georeferenced · 310 without coordinates

Open the mapobservation + sensor2 811

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 375≤1 km 460≤10 km 898>10 km 301

2 034 georeferenced · 194 without coordinates

Open the institutions mapphysical evidence2 228

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	764
Kensington, AU	301
Canberra, AU	272
Brisbane, AU	191
Mount Annan, AU	183
Museo Entomologico de Leonlocation not on record	160
Palmerston, AU	121
Armidale, AU	14
John T. Waterhouse Herbariumlocation not on record	14
Hobart, AU	12
Kew, GB	12
Saint Louis, US	9
NSW Dept of Planning, Industry and Environmentlocation not on record	9
Claremont, US	7
Auckland, NZ	7
BGPAlocation not on record	5
EL PASO, US	3
Stockholm, SE	3
MAlocation not on record	3
University of Stellenboschlocation not on record	3
Parkville, AU	3
James Cook Townsvillelocation not on record	1
Joondalup, AU	1
GB	1
Logan, US	1
Department of Land Resources Managementlocation not on record	1
Beijing, CN	1
Provo, US	1
Wlocation not on record	1
Llocation not on record	1
San Angelo, US	1
Smithfield, AU	1

32 institutions · 2 107 of 2 228 vouchered records shown · 120 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Eragrostis dielsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Eragrostis dielsii

At a glance

Sources7 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

Other traits1

At a glance

Record type5 064 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 064 records