Eragrostis ciliaris
(L.) R.Br. · speciesAt a glance
Occurrence records5 238
Data sources10
Biological traits30
DNA specimens19
eDNA detections9
Sources10 archives
Databases and archives Eragrostis ciliaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 238 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources30 traits
Occurrence & distributionGBIF5 238 records
Environmental DNA1 datasets · 4 countries9 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB2n = 20
01Narrative
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology9
Plant height0.45 m
⚠ sources differ — GIFT: 0.45 m · TRY: 0.675 m
Plant height max0.6 m
Plant height min0.15 m
Seed mass0.021 mg
⚠ sources differ — TRY: 0.021 mg · GIFT: 0.019 mg
Seed mass max0.028 mg
Seed mass min0.01 mg
Seed volume0.015 mm³
Seed volume max0.015 mm³
Seed volume min0.015 mm³
Life cycle & reproduction8
Deciduousnessevergreen
Flowering endMar
Flowering startFeb
Life formannual or perennial
Life spanannual
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Growth formherb
Habitat GIFTCaatinga (stricto sensu), Restinga
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis ciliaris has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes6
GenBank sequences10
eDNA detections9
Countries4
The DNA barcodea real sequence read deposited for this species
GGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCG …
Eragrostis ciliaris isolate Peru18300 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Eragrostis ciliaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records20–402n range20median20mode5records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 204×CCDB · book-ipcn65 · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 +1
CCDB · book-ipcn65 — Tateoka 1965b,
CCDB · book-ipcn67-71 — GOULD, F.W., & T.R. SODERSTROM. 1970. Chromosome numbers of some Mexican and Colombian grasses. Canad. J. Bot. 48: 1633-1639.
CCDB · book-indian_vol2 — de Wet, J.M.J. 1960a ; Tateoka, T. 1962a, 1965a, c ; Mehra, P.N. et al. 1968 ; Gould, F.W. & Soderstrom, T.R. 1970 ; Dujardin, M. 1978
CCDB · Cave1962 — Tateoka 1962
2n 401×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Moffett, A .A. & Hurcombe, R. 1949
n 105×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1987. Chromosomal and morphological variations in grasses of Punjab. J. Cytol. Genet. 22: 12–22.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2002. Chromosome studies on African plants. 18. The subfamily Chloridoideae. Bothalia 32(2): 240–249.
CCDB · ipcn-api-dl — Rao, P. N. & L. A. Mwasumbi. 1981. In Chromosome number reports LXX. Taxon 30: 79–80.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. II. An analysis of polyploidy. Taxon 52(4): 736–746.
CCDB · ipcn-api-dl — Roodt, R. & J. J. Spies. 2003. Chromosome studies in the grass subfamily Chloridoideae. I. Basic chromosome numbers. Taxon 52(3): 557–566.
n 202×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 152–154.
CCDB · ipcn-api-dl — Sinha, R. R. P., A. K. Bhardwaj & R. K. Singh. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 140–143.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 238 records
Wild obs. + sensor1 424
Museum / vouchered3 790
Cultivated / captive4
Other20
Origin
Native5
Introduced387
Range
Area of Occupancy AOO12 400 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy69% within 1 km
≤100 m 283≤1 km 213≤10 km 197>10 km 27
720 georeferenced · 704 without coordinates
Open the mapobservation + sensor1 424
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy58% within 1 km
≤100 m 238≤1 km 87≤10 km 166>10 km 74
565 georeferenced · 3 225 without coordinates
Open the institutions mapphysical evidence3 790
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 4 records without
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions110 of 242 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 351 |
| Pretoria, ZA | 212 |
| University of Stellenboschlocation not on record | 209 |
| Bronx, US | 204 |
| MeiseBGlocation not on record | 136 |
| Kew, GB | 124 |
| Puerto Ayora, EC | 124 |
| Durango, MX | 121 |
| National Biodiversity Institute, Costa Ricalocation not on record | 73 |
| UNIVASFlocation not on record | 67 |
| Tampa, US | 65 |
| Xiamen, CN | 63 |
| KMCClocation not on record | 59 |
| Durban, ZA | 52 |
| Miami, US | 48 |
| Université de Bordeauxlocation not on record | 43 |
| Baroda, IN | 39 |
| Laboratorio de Ictiologialocation not on record | 34 |
| Ann Arbor, US | 33 |
| Austin, US | 33 |
| Salvador, BR | 33 |
| Berlin, DE | 31 |
| Aarhus, DK | 31 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 28 |
| UFERSAlocation not on record | 27 |
| Masindi, UG | 27 |
| Forest Herbarium Ibadan (FHI)location not on record | 26 |
| St. Augustine, TT | 25 |
| Brasília, BR | 25 |
| San Diego, US | 24 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 23 |
| Antiguo Cuscatlán, SV | 22 |
| UFBAlocation not on record | 22 |
| Universidade Federal de Sergipe (UFS)location not on record | 22 |
| Mexico City, MX | 20 |
| Frankfurt am Main | 20 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 19 |
| HNBlocation not on record | 18 |
| Feira de Santana, BR | 17 |
| Altos de Pipe, VE | 15 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 15 |
| UFRPElocation not on record | 15 |
| UFESlocation not on record | 15 |
| Riverside, US | 14 |
| Blumenau, BR | 14 |
| Paris, FR | 14 |
| Federal University of Espírito Santolocation not on record | 14 |
| DanBIFlocation not on record | 14 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 14 |
| Universidade Federal do Maranhãolocation not on record | 14 |
| Bloomington, US | 13 |
| Ciudad de México, MX | 13 |
| La Paz, MX | 13 |
| Conservatoire Botanique National de Mascarinlocation not on record | 12 |
| UFMSlocation not on record | 12 |
| UnBlocation not on record | 12 |
| Istituto Agrario Castelnuovolocation not on record | 12 |
| Yaoundé, CM | 11 |
| Chaguaramas, TT | 11 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 11 |
| Cenargenlocation not on record | 11 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 11 |
| JBRJlocation not on record | 10 |
| UNESP-ISlocation not on record | 10 |
| Université du Lomélocation not on record | 10 |
| Brasília, BR | 10 |
| Instituto de Investigação Científica Tropicallocation not on record | 9 |
| San José, CR | 9 |
| Ciudad de México, MX | 9 |
| Plocation not on record | 9 |
| Mérida, MX | 9 |
| CEPLAClocation not on record | 8 |
| Stockholm, SE | 8 |
| Museu Paraense Emílio Goeldilocation not on record | 8 |
| TAFORI-LSRClocation not on record | 8 |
| Juriquilla, MX | 8 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| Uppsala, SE | 7 |
| Montréal, CA | 7 |
| Parthenon Tama History Museumlocation not on record | 7 |
| Culiacán, MX | 7 |
| ASUlocation not on record | 7 |
| MAlocation not on record | 7 |
| UFSMlocation not on record | 7 |
| San Isidro, AR | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| California Academy of Scienceslocation not on record | 7 |
| Chongqing Museumlocation not on record | 7 |
| Torreón, MX | 6 |
| Nanjing, CN | 6 |
| TAIElocation not on record | 6 |
| UNICAMPlocation not on record | 6 |
| BClocation not on record | 6 |
| Zapopan, MX | 6 |
| Departamento de Sistematica e Ecologialocation not on record | 6 |
| Edinburgh, GB | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Olocation not on record | 6 |
| Wuzhou, CN | 6 |
| Tapachula, MX | 5 |
| Universidad Nacional Federico Villarreallocation not on record | 5 |
| Fortaleza, BR | 5 |
| Taipei, TW | 5 |
| EFGlocation not on record | 5 |
| Auckland, NZ | 5 |
| EL PASO, US | 5 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 5 |
| Autlán de Navarro, MX | 5 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 5 |
| South Kensington, GB | 4 |
| IPA/SPlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| LBVlocation not on record | 4 |
| Mexico City, MX | 4 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| Université de Strasbourglocation not on record | 4 |
| Universität Tübingenlocation not on record | 4 |
| Pondicherry, IN | 4 |
| Wlocation not on record | 4 |
| Mexico City, MX | 4 |
| CASlocation not on record | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| Austin, US | 3 |
| Sanda, JP | 3 |
| Chapingo, MX | 3 |
| Mississippi State, US | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Dehra Dun, IN | 3 |
| MEXUlocation not on record | 3 |
| La Paz, BO | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| Taipei, TW | 3 |
| CPATSAlocation not on record | 3 |
| Cape Town, ZA | 3 |
| Claremont, US | 3 |
| Moscow State Universitylocation not on record | 3 |
| CNF-UFHBlocation not on record | 3 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Cape Town, ZA | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Chicago, US | 3 |
| New Mexico State Universitylocation not on record | 3 |
| Dekalb, US | 2 |
| IECOSlocation not on record | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| University of Hamburglocation not on record | 2 |
| Brussels, BE | 2 |
| Santa Teresa, BR | 2 |
| Chapel Hill, US | 2 |
| Cuiabá, BR | 2 |
| Guatemala City, GT | 2 |
| Fort Worth, US | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| VENlocation not on record | 2 |
| Mérida, MX | 2 |
| USP-IBlocation not on record | 2 |
| Cochabamba, BO | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Dresden, DE | 2 |
| BISHlocation not on record | 2 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 2 |
| Honolulu, US | 2 |
| INMAlocation not on record | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| Ivano-Frankivsk, UA | 2 |
| UFSClocation not on record | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 1 |
| ESALQlocation not on record | 1 |
| Taipei, TW | 1 |
| Guilin, CN | 1 |
| Columbia, US | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Coimbra, PT | 1 |
| GAlocation not on record | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| LSFlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| CJBGlocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| South African National Parks, Scientific Services, Kruger National Parklocation not on record | 1 |
| Linares, MX | 1 |
| Salamanca, ES | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Clemson, US | 1 |
| Badajoz, ES | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Philadelphia, US | 1 |
| San Francisco de Campeche, MX | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| LNBG$location not on record | 1 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 1 |
| UNICAPlocation not on record | 1 |
| UEMAlocation not on record | 1 |
| IAPlocation not on record | 1 |
| Mendoza, AR | 1 |
| UEMlocation not on record | 1 |
| Knoxville, US | 1 |
| Northridge, US | 1 |
| FTlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Corrientes, AR | 1 |
| Phoenix, US | 1 |
| The University of Arizonalocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Mount Pleasant, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| FLASlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| Odawara, JP | 1 |
| Londrina, BR | 1 |
| UFRRJlocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Guasave, MX | 1 |
| Arequipa, PE | 1 |
| Seropédica, BR | 1 |
| Glocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Ilhéus, BR | 1 |
| Sucre, BO | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Lubbock, US | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
242 institutions · 3 452 of 3 790 vouchered records shown · 338 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA9 detections
Where the DNA of Eragrostis ciliaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map4 countries0
Floodplain/ThicketDisturbed areas around buildings.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.9 °C 17.5–26.8
Seasonal swing summer↔winter7.90 °C
Max temp (day)29.2 °C 19.7–31.0
Min temp (night)20.6 °C 15.9–23.1
Precipitation94.6 mm/mo 1.50–209
Air humidity62.6 % 56.5–70.2
Moisture balance-58.2 mm/mo -121–61.5
Vapour deficit1,244 Pa 600–1,478
Wind speed2.80 m/s 2.30–3.40
Cloud cover57.7 % 23.3–65.4
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.