Eragrostis cilianensis
(All.) Vignolo ex Janch. · speciesAt a glance
Occurrence records17 222
Data sources11
Biological traits66
DNA specimens41
eDNA detections20
Sources11 archives
Databases and archives Eragrostis cilianensis's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility17 222 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI20 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics41 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources66 traits
Occurrence & distributionGBIF17 222 records
Environmental DNA1 datasets · 10 countries20 detections
DNA & barcodingBOLD · NCBI41 specimens
Genome at a glanceCCDB2n = 20
01Narrative
Eragrostis cilianensis is a species of grass known by several common names, including stinkgrass, candy grass, and gray lovegrass.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology24
Fruit length0.6 mm
Leaf length200 mm
Leaf length max182 mm
Leaf mass per area55.62 g/m2
Leaf size108 mm²
⚠ sources differ — TRY: 108 mm² · AusTraits: 78.7 mm²
Leaf width6 mm
⚠ sources differ — AusTraits: 6 mm · GIFT: 4 mm
Leaf width max4 mm
Leaf width min4 mm
Plant height0.303 m
⚠ sources differ — GIFT: 0.303 m · AusTraits: 0.75 m · LEDA: 0.15 m · TRY: 0.275 m
Plant height generative0.3 m
Plant height max0.9 m
Plant height min0.1 m
Seed length0.6 mm
Seed length max0.6 mm
Seed length min0.6 mm
Seed mass0.079 mg
⚠ sources differ — TRY: 0.079 mg · AusTraits: 0.075 mg · GIFT: 0.071 mg
Seed mass max0.11 mg
Seed mass min0.02 mg
Seed volume0.057 mm³
Seed volume max0.057 mm³
Seed volume min0.057 mm³
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction14
Deciduousnessaestival
Dispersal typeself
⚠ sources differ — AusTraits: barochory · LEDA: epizoochor · GIFT: anemochorous
Flowering endApr
Flowering startMay
Flowering timeyynnnnnnnnny
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formlinear
Leaf shapefiliform
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio16.41 g/g
Leaf c447 mg/g
Leaf dry-matter content (LDMC)307 mg/g
Leaf n26.23 mg/g
Leaf p2.14 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Specific leaf area (SLA)24.1 mm²/mg
Other traits5
Diaspore typefruit
Leaf marginentire
Leaf spinesno
Leaf thornsno
Seeds per fruit101-1000
05DNA & barcoding41 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eragrostis cilianensis has left across the world's sequence archives.
At a glance
DNA specimens41
Marker genes9
GenBank sequences10
eDNA detections20
Countries10
The DNA barcodea real sequence read deposited for this species
TTGTCGTGACCCTGACCAAAACAGACCGTGAACGTGTCATCCATCCTGCCGGGTGACGGGGCTTGCCTCGCCTCCCGGTTAGGCCCCAGA …
Eragrostis cilianensis voucher B11_K1341 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL3★rbcLa★trnL★trnL-F★ITS7★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Eragrostis cilianensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidydiploid inferred
Chromosome records20–702n range20median20mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2012×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +6
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · fl-europaea — Fernandes % Queiros,
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-ipcn67-71 — REEDER, J.R. 1971. Notes on Mexican grasses IX. Miscellaneous chromosome number.s - 3. Brittonia 23: 105-117.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-indian_vol2 — Malik, C.P. & Tripathi, R.C. 1970 ; Reeder, J.R. 1971 ; Dujardin, M. 1979a
CCDB · book-indian_vol2 — Adulov, N.P. (Fedorov); Parodi, l.R. 1946; Tateoka, T. 195-l; Fernandes, A. & Queiros, M. 1969
CCDB · book-atlas-flowering-plants — Moffett & H. 1949
CCDB · Cave1956supp — Tateoka 1955
CCDB · CromoCat 2015 — Reeder, J. R. (1971). Notes on Mexican grasses IX. Miscellaneous chromosome numbers. 3. Brittonia 23: 105-117.
CCDB · CromoCat 2015 — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya (1996). Chromosome numbers in synanthropic plants fromt he Russian Far East. Bot. Zhurn. 81(5): 98-101
2n 406×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · eflora +1
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · book-indian_vol2 — Ono, H. & Tateoka, T. 1953
CCDB · eflora
CCDB · CromoCat 2015 — Fernandes, A. & França, F. (1975). Sur les nombres chromosomiques de quelques plantes du Mozambique. Revista Ci. Biol., Sér. A 7: 83-106.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
2n 701×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mehra, P.N. et al. 1968
n 1019×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). III. Devesa, J. A. & al.Bol. Soc. Brot. ser. 264: 35-74(1991).
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 58–59.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1985. Cytological investigations on some grasses from Punjab Plain, North India. Proc. Indian Natl. Sci. Acad., B 5: 609–626.
CCDB · ipcn-api-dl — DUJARDIN, M. 1979. Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canad. J. Bot. 57: 864–876.
CCDB · ipcn-api-dl — Faruqi, S. A., H. B. Quraish & M. Inamuddin. 1987. Studies in Libyan grasses X. Chromosome number and some interesting features. Ann. Bot. (Rome) 45: 75–102.
CCDB · ipcn-api-dl — Spies, J. J., E. v. Merwe, H. d. Plessis & E. J. L. Saayman. 1991. Basic chromosome numbers and polyploid levels in some South African and Australian grasses (Poaceae). Bothalia 21(2): 163–170.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, M. C. Viera, R. Tormo, F. Vázquez, J. P. Carrasco, A. Ortega & J. Pastor. 1991. Contribución al conocimiento cariológico de las Poaceae en Extremadura (España)---III. Bol. Soc. Brot., sér. 2 64: 35–74.
CCDB · ipcn-api-dl — Moinuddin, M., A. A. Vahidy & S. I. Ali. 1994. Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 784–791.
CCDB · book-ipcn66 — Singh & Godward 1960
CCDB · book-ipcn67-71 — MALIK, C.P., & R.C. TRIPATHI. 1970. In IOPB chromosome number reports XXVII. Taxon 19: 437-442.
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1983). SOCGI plant chromosome number reports -- I J. Cytol. Genet. 18: 58-59
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1985). Cytological investigations on some grasses from Punjab Plain, North India. Proceedings of the Indian National Science Academy. Part B, Biological Sciences 5: 609-626
CCDB · CromoCat 2015 — Dujardin, M. (1979b). Additional chromosome numbers and meiotic behaviour in tropical African grasses from western Zaire. Canadian Journal of Botany 57: 864-876.
CCDB · CromoCat 2015 — Malik, C. P. & Tripathi, R. C. (1970). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXVII]. Taxon 19(3): 439-440.
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
CCDB · CromoCat 2015 — Faruqi, S. A., Quraish, H. B. & Inamuddin, M. (1987). Studies in Libyan grasses X. Chromosome number and some interesting features Annali di Botanica 45: 75-102
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · CromoCat 2015 — Spies, J. J., E. van der Merwe, H. du Plessis & E. J. L. Saayman (1991). Basic chromosome numbers and polyploid levels in some South African and Australian grasses (Poaceae) Bothalia 21(2): 163-170
CCDB · CromoCat 2015 — Devesa, J. A., Ruíz, T., Viera, M., Tormo, R., Vázquez, F., Carrasco, J., Ortega, A. & Pastor, J. (1991). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). III. Bol. Soc. Brot. 64: 35-74.
n 203×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Bir, S. S. & M. Sahni. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 152–154.
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1986). SOCGI plant chromosome number reports -- IV J. Cytol. Genet. 21: 152-154
CCDB · CromoCat 2015 — Bir, S. S. & Sahni, M. (1988). Cytomorphological studies on members of genus Eragrostis V. Wolf. from Punjab Plain (north India) Journal of Cytology and Genetics 23: 118-131
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type17 222 records
Wild obs. + sensor7 440
Museum / vouchered9 602
Cultivated / captive12
Other168
Origin
Native112
Introduced2 731
Range
Area of Occupancy AOO45 412 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 2 523≤1 km 674≤10 km 2 603>10 km 102
5 902 georeferenced · 1 538 without coordinates
Open the mapobservation + sensor7 440
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 914≤1 km 1 063≤10 km 1 916>10 km 381
4 274 georeferenced · 5 328 without coordinates
Open the institutions mapphysical evidence9 602
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 12 records without
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions246 of 433 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 451 |
| Pretoria, ZA | 416 |
| Bronx, US | 327 |
| Saint Louis, US | 299 |
| Adelaide, AU | 239 |
| Brisbane, AU | 239 |
| University of Stellenboschlocation not on record | 235 |
| International Salmonella Centre (W.H.O.)location not on record | 214 |
| Mount Annan, AU | 203 |
| ASUlocation not on record | 198 |
| Canberra, AU | 194 |
| San Diego, US | 190 |
| Beijing, CN | 173 |
| Kew, GB | 154 |
| San Isidro, AR | 149 |
| BIO-UNIPIlocation not on record | 131 |
| Museo Entomologico de Leonlocation not on record | 125 |
| Ann Arbor, US | 125 |
| Madison, US | 121 |
| Córdoba, AR | 117 |
| Austin, US | 110 |
| MeiseBGlocation not on record | 102 |
| Berlin, DE | 102 |
| Chongqing Museumlocation not on record | 99 |
| Riverside, US | 97 |
| Bloomington, US | 92 |
| UNIVASFlocation not on record | 90 |
| Claremont, US | 90 |
| Flagstaff, US | 87 |
| St. Paul, US | 85 |
| Durango, MX | 78 |
| BClocation not on record | 74 |
| Spearfish, US | 72 |
| Fort Worth, US | 68 |
| BDBClocation not on record | 68 |
| Puerto Ayora, EC | 67 |
| KMCClocation not on record | 63 |
| Denver, US | 61 |
| Bern, CH | 60 |
| La Paz, MX | 59 |
| Logan, US | 59 |
| Albuquerque, US | 57 |
| Chadron, US | 55 |
| Kensington, AU | 52 |
| Mexico City, MX | 51 |
| Davis, US | 51 |
| Phoenix, US | 49 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 47 |
| Guasave, MX | 46 |
| EL PASO, US | 46 |
| Burlington, US | 41 |
| Philadelphia, US | 41 |
| Ciudad Autónoma de Buenos Aires, AR | 37 |
| Palmerston, AU | 37 |
| Xiamen, CN | 37 |
| Barcelona, ES | 33 |
| Corvallis, US | 32 |
| College Park, US | 32 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 32 |
| Nagano City, JP | 31 |
| Sanda, JP | 31 |
| Kunming, CN | 31 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 31 |
| Missoula, US | 30 |
| Santa Barbara, US | 30 |
| Guangzhou, CN | 30 |
| Brussel, BE | 30 |
| Hobart, AU | 30 |
| Tampa, US | 30 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 29 |
| Xining, CN | 29 |
| Cape Town, ZA | 29 |
| Moscow, US | 28 |
| LDlocation not on record | 28 |
| Durban, ZA | 27 |
| Helsinki, FI | 26 |
| Salamanca, ES | 25 |
| Lubbock, US | 25 |
| València, ES | 24 |
| Williamsburg, US | 24 |
| Auckland, NZ | 23 |
| Torreón, MX | 23 |
| CJBGlocation not on record | 23 |
| Frankfurt am Main | 22 |
| Pullman, US | 22 |
| Corrientes, AR | 22 |
| Hermosillo, MX | 22 |
| University of New Hampshirelocation not on record | 22 |
| Provo, US | 22 |
| Armidale, AU | 21 |
| Canadian Department of Agriculturelocation not on record | 21 |
| Vancouver, CA | 20 |
| New Haven, US | 20 |
| MAlocation not on record | 20 |
| Zacatecas, MX | 19 |
| Yangling, CN | 19 |
| Pittsburg, US | 18 |
| Taipei, TW | 18 |
| Nanjing, CN | 17 |
| Chengdu, CN | 17 |
| Shinshu Universitylocation not on record | 17 |
| Mexico City, MX | 17 |
| Mississippi State, US | 17 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 17 |
| Paris, FR | 17 |
| Montecillo, Texcoco, MX | 17 |
| Chengdu, CN | 17 |
| BAYLUlocation not on record | 16 |
| Zhengzhou, CN | 16 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 16 |
| Aarhus, DK | 16 |
| WNNUlocation not on record | 15 |
| Comisión Técnico Consultiva de Coeficientes de Agostaderolocation not on record | 15 |
| Odawara, JP | 15 |
| Baroda, IN | 15 |
| South Kensington, GB | 14 |
| Adam Mickiewicz University in Poznańlocation not on record | 14 |
| Austin, US | 14 |
| Universität Basel, Herbariumlocation not on record | 14 |
| Arcata, US | 14 |
| Castelar, AR | 13 |
| Nishihara, JP | 13 |
| Moscow State Universitylocation not on record | 13 |
| Staten Island, US | 12 |
| IDElocation not on record | 12 |
| Emporia, US | 12 |
| Toyama, JP | 12 |
| The University of Arizonalocation not on record | 11 |
| Ciudad de México, MX | 11 |
| San Luis Obispo, US | 11 |
| Yunnan Universitylocation not on record | 11 |
| Cape Town, ZA | 11 |
| Zapopan, MX | 11 |
| Wuhan, CN | 11 |
| Dresden, DE | 11 |
| Irvine, US | 11 |
| Badajoz, ES | 10 |
| DOI/NPS, Greenbelt Parklocation not on record | 10 |
| Dekalb, US | 10 |
| Lincoln, US | 10 |
| Bend, US | 10 |
| Boise, US | 10 |
| John T. Waterhouse Herbariumlocation not on record | 10 |
| Awka, NG | 10 |
| BISHlocation not on record | 9 |
| Smithfield, AU | 9 |
| Honolulu, US | 9 |
| EFGlocation not on record | 9 |
| CASlocation not on record | 9 |
| Olocation not on record | 9 |
| Zürich, CH | 9 |
| Bozeman, US | 8 |
| Christchurch, NZ | 8 |
| Juriquilla, MX | 8 |
| Tokushima, JP | 8 |
| Tomioka, JP | 8 |
| Wlocation not on record | 8 |
| Jackson, US | 8 |
| Wuhan, CN | 8 |
| Kochi, JP | 8 |
| Madrid, ES | 8 |
| Henderson, US | 8 |
| DanBIFlocation not on record | 8 |
| Tempe, US | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Edinburgh, GB | 7 |
| Changsha, CN | 7 |
| Millersville, US | 7 |
| Tsukuba, JP | 7 |
| Autlán de Navarro, MX | 7 |
| Chapel Hill, US | 7 |
| National Institute of Biological Resourceslocation not on record | 7 |
| Muzaffarabad, PK | 7 |
| BAlocation not on record | 7 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 7 |
| San Angelo, US | 7 |
| Nishihara, JP | 7 |
| Yaoundé, CM | 7 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 6 |
| UFERSAlocation not on record | 6 |
| GB | 6 |
| Morgantown, US | 6 |
| Ciudad de México, MX | 6 |
| Conservatoire Botanique National de Mascarinlocation not on record | 6 |
| Pondicherry, IN | 6 |
| GZUlocation not on record | 6 |
| Shanxi Institute of Biologylocation not on record | 6 |
| Bando, JP | 6 |
| Tuscaloosa, US | 6 |
| Tlalnepantla, MX | 6 |
| Plocation not on record | 6 |
| Oskarshamn, SE | 6 |
| GJOlocation not on record | 6 |
| Northridge, US | 6 |
| Stockholm, SE | 6 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Central China Normal Universitylocation not on record | 5 |
| Uppsala, SE | 5 |
| US | 5 |
| Antiguo Cuscatlán, SV | 5 |
| Rotorua, NZ | 5 |
| Whitewater, US | 5 |
| JBSlocation not on record | 5 |
| Green Bay, US | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Bourges, FR | 5 |
| Grand Junction, US | 5 |
| Görlitz, DE | 5 |
| Sagamihara, JP | 5 |
| KR | 5 |
| Otaru, JP | 5 |
| Chapingo, MX | 5 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 5 |
| Guangzhou, CN | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Northeastern Forestry Universitylocation not on record | 5 |
| JP | 5 |
| Pocatello, US | 5 |
| Caldwell, US | 5 |
| Southwest Forestry Collegelocation not on record | 5 |
| KIRMlocation not on record | 5 |
| Los Angeles, US | 4 |
| Cenargenlocation not on record | 4 |
| Macomb, US | 4 |
| Montréal, CA | 4 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 4 |
| PRClocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Little Rock, US | 4 |
| Dover, US | 4 |
| Ensenada, MX | 4 |
| Denton, US | 4 |
| NSW Office of Environment and Heritagelocation not on record | 4 |
| Urumqi, CN | 4 |
| Guilin, CN | 4 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 4 |
| TAFORI-LSRClocation not on record | 4 |
| Forest Herbarium Ibadan (FHI)location not on record | 4 |
| Université de Bordeauxlocation not on record | 4 |
| Knoxville, US | 4 |
| UFSMlocation not on record | 4 |
| Acadia Universitylocation not on record | 4 |
| Cambridge University Herbariumlocation not on record | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Toronto, CA | 3 |
| Coimbra, PT | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| WINlocation not on record | 3 |
| León, NI | 3 |
| UGentlocation not on record | 3 |
| Xian, CN | 3 |
| LNBG$location not on record | 3 |
| Bratislava, SK | 3 |
| Philadelphia, US | 3 |
| Jaén, ES | 3 |
| Brookings, US | 3 |
| Santa Cruz, US | 3 |
| MEXUlocation not on record | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| Springfield, US | 3 |
| Akita Prefectural Museumlocation not on record | 3 |
| Mlocation not on record | 3 |
| ENTClocation not on record | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Chicago, US | 3 |
| US | 3 |
| Universidad Nacional de La Pampalocation not on record | 3 |
| CPATSAlocation not on record | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Columbia, US | 3 |
| Oulu, FI | 3 |
| San Luis Potosí, MX | 3 |
| Xian, CN | 3 |
| Llocation not on record | 3 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 3 |
| Masindi, UG | 3 |
| Wellington, NZ | 3 |
| Peking Universitylocation not on record | 3 |
| J. Rusek Collectionlocation not on record | 3 |
| Chaguaramas, TT | 2 |
| Taipei, TW | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Batemans Bay, AU | 2 |
| California Academy of Scienceslocation not on record | 2 |
| UIBlocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| TAIElocation not on record | 2 |
| Edmonton, CA | 2 |
| Elocation not on record | 2 |
| Orem, US | 2 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 2 |
| Sevilla, ES | 2 |
| Bangkok, TH | 2 |
| Hazara Universitylocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| AUAlocation not on record | 2 |
| DBF-NHMDlocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| MCNAMlocation not on record | 2 |
| Vitoria, ES | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 2 |
| University of Wisconsinlocation not on record | 2 |
| Londrina, BR | 2 |
| Mazatlán, MX | 2 |
| Parkville, AU | 2 |
| Norfolk, US | 2 |
| Bergen, NO | 2 |
| Lanzhou, CN | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Hangzhou, CN | 2 |
| Brasília, BR | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Salta, AR | 2 |
| USFSlocation not on record | 2 |
| Loja, EC | 2 |
| Alicante, ES | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| BRNUlocation not on record | 2 |
| Ciudad Juárez, MX | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Centre National des Semences Forestièreslocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Turku, FI | 2 |
| Waverly, US | 2 |
| La Paz, BO | 1 |
| Bogotá, D.C., CO | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| South African National Biodiversity Institutelocation not on record | 1 |
| Frauenfeld, CH | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| South African National Parks, Scientific Services, Kruger National Parklocation not on record | 1 |
| Lausanne, CH | 1 |
| Granada, ES | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Seoul, KR | 1 |
| Shanghai, CN | 1 |
| Universität Tübingenlocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| CBGlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Arusha, TZ | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Davenport, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Fundación Miguel Lillolocation not on record | 1 |
| Universidad de Buenos Aireslocation not on record | 1 |
| Johnson City, US | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Miami, US | 1 |
| Brasília, BR | 1 |
| Durham, US | 1 |
| San José, CR | 1 |
| Long Beach, US | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Salvador, BR | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Feira de Santana, BR | 1 |
| UFPIlocation not on record | 1 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Glocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Culiacán, MX | 1 |
| UFRPElocation not on record | 1 |
| Porto Alegre, BR | 1 |
| University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| BMlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| US | 1 |
| DMZ botanic gardenlocation not on record | 1 |
| Due West, US | 1 |
| Salzburg, AT | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| US | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| LINUlocation not on record | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Carter County Museumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Fayetteville, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Maringá, BR | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Podgorica, ME | 1 |
| UFBAlocation not on record | 1 |
| UEMlocation not on record | 1 |
| University of Hargeisalocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| BFLlocation not on record | 1 |
| UFESlocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Puebla, MX | 1 |
| Kirksville, US | 1 |
| HACAMlocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| New Brunswick, US | 1 |
| Porrentruy, CH | 1 |
| San Francisco, US | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| UnBlocation not on record | 1 |
| Jefferson City, US | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| San Jose, US | 1 |
433 institutions · 9 253 of 9 602 vouchered records shown · 346 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA20 detections
Where the DNA of Eragrostis cilianensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found20
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 20 detections have coordinates
Open the map10 countries0
red soilNear river edge;Red soil
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.0 °C 13.7–24.9
Seasonal swing summer↔winter10.8 °C
Max temp (day)25.5 °C 17.4–29.5
Min temp (night)13.5 °C 8.80–21.6
Precipitation70.4 mm/mo 13.2–101
Air humidity57.4 % 49.9–65.2
Moisture balance-68.6 mm/mo -107–-20.2
Vapour deficit1,003 Pa 759–1,322
Wind speed3.00 m/s 1.90–4.00
Cloud cover36.9 % 25.1–51.1
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.