Equisetum sylvaticum
speciesAt a glance
Occurrence records259 957
Data sources14
Biological traits112
DNA specimens38
eDNA detections31
Sources14 archives
Databases and archives Equisetum sylvaticum's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility259 957 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources112 traits
Chemical compositionLOTUS25 compounds
Occurrence & distributionGBIF259 957 records
Environmental DNA2 datasets · 6 countries31 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT12.9 Gbp
01Narrative
Equisetum sylvaticum, the wood horsetail, is a horsetail (family Equisetaceae) native to the Northern Hemisphere, occurring in North America and Eurasia. Because of its lacy appearance, it is considered among the most attractive of the horsetails.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology6
Leaf mass12.19 mg
Leaf size7.77 mm²
⚠ sources differ — TRY: 7.77 mm² · LEDA: 302 mm² · GIFT: 302 mm²
Plant height0.297 m
⚠ sources differ — GIFT: 0.297 m · LEDA: 0.325 m · USDA: 0.274 m · TRY: 0.274 m
Plant height generative0.325 m
Plant height max0.75 m
Plant height min0.15 m
Life cycle & reproduction32
After harvest regrowth rateSlow
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal type detailedanemochorous
Flower colourgreen
Flower conspicuousNo
Flowering endJun
Flowering startApr
Fruit seed period beginSpring
Fruit seed period endFall
Growth rate USDARapid
Life formrhizomatous geophyte
Life spanperennial
Lifespan categoryShort
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersYes
Raunkiær life formcryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Vegetative spread rateModerate
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment27
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourgreen
Fruit typeother
Growth formherb
⚠ sources differ — GIFT: herb · TRY: fern
Growth form USDARhizomatous
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min100 days
Leaf C:N ratio21.8 g/g
Leaf c415 mg/g
Leaf dry-matter content (LDMC)267 mg/g
⚠ sources differ — TRY: 267 mg/g · LEDA: 237 mg/g
Leaf n23.04 mg/g
Leaf p1.04 mg/g
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max100 in
Precipitation min20 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceLow
Soil pH max6.5 pH
Soil pH min4 pH
Specific leaf area (SLA)22.27 mm²/mg
⚠ sources differ — TRY: 22.27 mm²/mg · LEDA: 24.58 mm²/mg · GIFT: 24.58 mm²/mg
Temperature min-43 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityModerate
Veneer productNo
Other traits7
Diaspore typespore
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max10 912 per acre
Planting density min1 936 per acre
03Chemical composition25 compounds
Compounds documented for Equisetum sylvaticum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Carotenoids (C40, β-β)10
Flavonols6
Carotenoids (C40, β-ε)3
Carotenoids (C40, Ψ-Ψ)2
Carotenoids (C40, β-Ψ)1
Documented compounds25 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 2-[(1S,5S)-4-oxo-5-[(Z)-pent-2-enyl]cyclopent-2-en-1-yl]acetic acid | present | LOTUS | |
| 5-O-Caffeoylshikimic acid | present | LOTUS | |
| Adonixanthin | present | LOTUS | |
| all-trans-Neoxanthin | present | LOTUS | |
| alpha-Carotene | present | LOTUS | |
| Astragalin | present | LOTUS | |
| Astragalin 7-glucoside | present | LOTUS | |
| beta-Carotene | present | LOTUS |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Equisetum sylvaticum has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes8
GenBank sequences10
eDNA detections31
Countries7
The DNA barcodea real sequence read deposited for this species
TGCTGAATCGTCCACGGGCACCTGGACTACCGTATGGACAGATGGACTTACTAGTCTTGATCGATATAAAGGTCGATGCTATAATATTGA …
Equisetum sylvaticum voucher KS23 HER0487 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL9★rbcLa★trnL★trnL-F★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Equisetum sylvaticum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size12 894 930 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Equisetum sylvaticum12.89 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 216 n = 108
Ploidy2× diploid · measured
Chromosome records216–2162n range216median216mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2169×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl +3
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1465
CCDB · book-LoveLove1977 — Hagerup (in Hagerup & Petersson 1960)
CCDB · book-LoveLove1977 — Liive (in Bir 1960b)
CCDB · book-LoveLove1977 — Love & Love 1961d
CCDB · book-LoveLove1977 — Love & Love (in Love 1976
CCDB · eflora
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIII]. Taxon 25(4): 484-487.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
07Deep time~8.71 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin8.71 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type259 957 records
Wild obs. + sensor243 030
Museum / vouchered16 133
Cultivated / captive11
Fossil1
Other782
Origin
Native12 344
Range
Area of Occupancy AOO449 496 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 77 380≤1 km 63 235≤10 km 65 206>10 km 1 879
207 700 georeferenced · 35 330 without coordinates
Open the mapobservation + sensor243 030
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 1 174≤1 km 2 906≤10 km 5 655>10 km 1 130
10 865 georeferenced · 5 268 without coordinates
Open the institutions mapphysical evidence16 133
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 8
8 georeferenced · 3 without coordinates
Open the mapnot free-living11
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 282 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 4 007 |
| Helsinki, FI | 618 |
| Moscow State Universitylocation not on record | 594 |
| Université Lavallocation not on record | 586 |
| LDlocation not on record | 506 |
| Olocation not on record | 327 |
| Philadelphia, US | 322 |
| St. Paul, US | 306 |
| Institute of Plant and Animal Ecology Ural Branch of the Russian Academy of Scienceslocation not on record | 284 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 252 |
| Salzburg, AT | 246 |
| MeiseBGlocation not on record | 234 |
| Madison, US | 224 |
| BFLlocation not on record | 198 |
| Québec, CA | 188 |
| Chongqing Museumlocation not on record | 185 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 183 |
| Provincia di Livornolocation not on record | 171 |
| Trondheim, NO | 162 |
| Bergen, NO | 159 |
| University of Silesia in Katowicelocation not on record | 154 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 149 |
| Ann Arbor, US | 127 |
| Oulu, FI | 124 |
| University of Alberta Museumslocation not on record | 124 |
| Zürich, CH | 123 |
| Oskarshamn, SE | 118 |
| Chicago, US | 118 |
| Zürich, CH | 112 |
| Bronx, US | 111 |
| Turku, FI | 109 |
| KMNlocation not on record | 107 |
| TROMlocation not on record | 106 |
| Jyväskylä, FI | 92 |
| University of New Hampshirelocation not on record | 91 |
| SLU Artdatabankenlocation not on record | 87 |
| Acadia Universitylocation not on record | 86 |
| Burlington, US | 86 |
| Montréal, CA | 79 |
| Vancouver, CA | 77 |
| WINlocation not on record | 75 |
| Victoria, CA | 74 |
| Minia, EG | 72 |
| Irkutsk State Universitylocation not on record | 72 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 71 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 71 |
| WTUlocation not on record | 71 |
| IFR-DNFlocation not on record | 70 |
| McWane Science Centerlocation not on record | 65 |
| Udmurt State Universitylocation not on record | 64 |
| University of Calgarylocation not on record | 63 |
| Garðabær, IS | 62 |
| Green Bay, US | 61 |
| South Kensington, GB | 58 |
| Saint John, CA | 58 |
| Kuopio, FI | 58 |
| Görlitz, DE | 57 |
| Chapel Hill, US | 54 |
| TUR-Alocation not on record | 54 |
| Tallinn, EE | 51 |
| Tyumen State Universitylocation not on record | 45 |
| Moscow, US | 45 |
| Uppsala, SE | 42 |
| Pullman, US | 41 |
| Toronto, CA | 40 |
| Wuzhou, CN | 39 |
| CJBGlocation not on record | 35 |
| Tartu, EE | 34 |
| Missoula, US | 33 |
| Dresden, DE | 33 |
| Bern, CH | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 31 |
| University of Stellenboschlocation not on record | 29 |
| GZUlocation not on record | 29 |
| Trois-Rivières, CA | 27 |
| Morgantown, US | 27 |
| Uniwersytet Warszawskilocation not on record | 27 |
| Brookings, US | 26 |
| Northeastern Forestry Universitylocation not on record | 26 |
| Kandalaksha State Nature Reservelocation not on record | 26 |
| Uniwersytet Śląski w Katowicachlocation not on record | 25 |
| Tampere, FI | 25 |
| Porvoo, FI | 24 |
| BRNUlocation not on record | 23 |
| GJOlocation not on record | 23 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 22 |
| DBF-NHMDlocation not on record | 22 |
| Brussel, BE | 21 |
| Auckland, NZ | 20 |
| Frankfurt am Main | 19 |
| Tula State Universitylocation not on record | 19 |
| Montréal, CA | 19 |
| Institute of Biology Ufa Scientific Centre of Russian Academy of Scienceslocation not on record | 19 |
| Berlin, DE | 19 |
| Rovaniemi, FI | 18 |
| Fort Worth, US | 17 |
| Philadelphia, US | 17 |
| Tsukuba, JP | 17 |
| Bloomington, US | 16 |
| Millersville, US | 16 |
| Stockholm, SE | 16 |
| Provo, US | 16 |
| Wlocation not on record | 16 |
| Chelyabinsk State Universitylocation not on record | 14 |
| MAlocation not on record | 13 |
| Durham, US | 12 |
| US | 12 |
| University of Winnipeglocation not on record | 11 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Mlocation not on record | 11 |
| Tampa, US | 10 |
| Paris, FR | 10 |
| Porrentruy, CH | 10 |
| IPDNlocation not on record | 10 |
| Entomological Society of Latvialocation not on record | 9 |
| 东北师范大学自然博物馆location not on record | 9 |
| BClocation not on record | 9 |
| València, ES | 8 |
| Beijing, CN | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Tilburg, NL | 8 |
| Anchorage, US | 8 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 8 |
| Corvallis, US | 8 |
| Wellington, NZ | 8 |
| Glarus, CH | 8 |
| Boise, US | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Barcelona, ES | 7 |
| PRClocation not on record | 7 |
| Austin, US | 7 |
| Servico de Microbiologia e Imunologialocation not on record | 7 |
| Bangkok, TH | 7 |
| New Haven, US | 7 |
| Urumqi, CN | 7 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 7 |
| Forssa, FI | 7 |
| Yukon Universitylocation not on record | 7 |
| Madrid, ES | 6 |
| NMBU:MINAlocation not on record | 6 |
| Philadelphia, US | 6 |
| Kyoto Universitylocation not on record | 6 |
| Whitewater, US | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Dekalb, US | 6 |
| Podgorica, ME | 6 |
| EL PASO, US | 6 |
| University of Wisconsinlocation not on record | 6 |
| SZUlocation not on record | 6 |
| Bozeman, US | 5 |
| Staten Island, US | 5 |
| Flagstaff, US | 5 |
| Tempe, US | 5 |
| Sion, CH | 5 |
| nbflocation not on record | 5 |
| Columbia, US | 5 |
| Frauenfeld, CH | 5 |
| University of Lethbridgelocation not on record | 4 |
| Vitoria, ES | 4 |
| Whitehorse, CA | 4 |
| San Sebastián, ES | 4 |
| Namur, BE | 4 |
| Johnson City, US | 4 |
| USFS/BHSClocation not on record | 4 |
| Bourges, FR | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| UGentlocation not on record | 4 |
| BSBIlocation not on record | 4 |
| Tacoma, US | 4 |
| US | 4 |
| UFPRlocation not on record | 4 |
| Waverly, US | 4 |
| Saint Louis, US | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Mohonk Preservelocation not on record | 3 |
| GB | 3 |
| New Brunswick, US | 3 |
| DULlocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Keene State Universitylocation not on record | 3 |
| Göteborg, SE | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Davenport, US | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Copenhagen, DK | 3 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Winterthur, CH | 3 |
| CICYTEXlocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Cincinnati, US | 3 |
| San Angelo, US | 3 |
| Taipei, TW | 3 |
| Chadron, US | 3 |
| IMMUlocation not on record | 3 |
| Tromso University Museumlocation not on record | 3 |
| Denver, US | 3 |
| Granada, ES | 3 |
| Dhaka, BD | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| BIO-UNIPIlocation not on record | 3 |
| FLADlocation not on record | 3 |
| Nanjing, CN | 3 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Lausanne, CH | 2 |
| Santiago de Compostela, ES | 2 |
| Fullerton, US | 2 |
| UFRRJlocation not on record | 2 |
| Hobart, AU | 2 |
| US | 2 |
| University of Salzburglocation not on record | 2 |
| Mississippi State, US | 2 |
| CASlocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Oswego, US | 2 |
| BAYLUlocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Guangzhou, CN | 2 |
| CJBNlocation not on record | 2 |
| Canadian Museum of Naturelocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 2 |
| Salamanca, ES | 2 |
| Logan, US | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| PrivatHerblocation not on record | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Canberra, AU | 2 |
| Fulda, DE | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Miami, US | 2 |
| Boumlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Kew, GB | 1 |
| Lincoln, US | 1 |
| Norfolk, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Pamplona, ES | 1 |
| Museo Achille Folettolocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| EEZA-CSIClocation not on record | 1 |
| Spearfish, US | 1 |
| 1 | |
| Christchurch, NZ | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Mount Annan, AU | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Alicante, ES | 1 |
| Hudson, US | 1 |
| San Luis Obispo, US | 1 |
| Xiamen, CN | 1 |
| Fredericksburg, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| CBDClocation not on record | 1 |
| NMWlocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| nlocation not on record | 1 |
| Chicago, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| San Diego, US | 1 |
| Hamilton, US | 1 |
| Siberian forest experimental stationlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Nanjing, CN | 1 |
| Clemson, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Northridge, US | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| SWlocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
282 institutions · 15 017 of 16 133 vouchered records shown · 965 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Equisetum sylvaticum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys2
Countries6
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map6 countries0
in heathy, grassy habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.4 °C 6.10–18.5
Seasonal swing summer↔winter27.0 °C
Max temp (day)17.9 °C 11.0–22.9
Min temp (night)8.90 °C 1.90–15.3
Precipitation83.3 mm/mo 61.2–102
Air humidity59.9 % 55.4–65.4
Moisture balance-34.1 mm/mo -74.3–14.3
Vapour deficit691 Pa 395–875
Wind speed3.10 m/s 2.70–5.90
Cloud cover45.2 % 38.6–64.2
CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.