Equisetum ramosissimum
Desf. · speciesAt a glance
Occurrence records35 422
Data sources11
Biological traits34
DNA specimens23
eDNA detections11
Sources11 archives
Databases and archives Equisetum ramosissimum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility35 422 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources34 traits
Chemical compositionLOTUS19 compounds
Occurrence & distributionGBIF35 422 records
Environmental DNA1 datasets · 4 countries11 detections
DNA & barcodingBOLD · NCBI23 specimens
Genome at a glanceCCDB27.5 Gbp
01Narrative
Equisetum ramosissimum, communément appelée Prêle rameuse ou Prêle très rameuse, est une espèce de prêles présente en Europe. Elle se propage principalement par voie végétative. Par hybridation avec Equisetum hyemale elle donne Equisetum × moorei.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology4
Plant height0.9 m
⚠ sources differ — GIFT: 0.9 m · LEDA: 0.9 m · TRY: 0.733 m
Plant height generative0.9 m
Plant height max1.51 m
Plant height min0.2 m
Life cycle & reproduction10
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal type detailedanemochorous
Flowering endJul
Flowering startMay
Life formrhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
Reproduction asexualabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 500 m
Elevation mean2 300 m
Elevation min10 m
Epiphyteterrestrial
Fruit typeother
Growth formherb
⚠ sources differ — GIFT: herb · TRY: fern
Habitat GIFTsand, semidesert, steppe
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)478 mg/g
Leaf n14.5 mg/g
Leaf p1.89 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Diaspore typespore
03Chemical composition19 compounds
Compounds documented for Equisetum ramosissimum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Megastigmanes6
Cinnamic acids and derivatives4
Flavonols2
Neolignans2
Cholestane steroids1
Documented compounds19 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3R,4S,5S,6R)-2-((Z)-hex-3-enoxy)-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,2S)-4-[(1R,2R,4R)-1,2,4-trihydroxy-2,6,6-trimethylcyclohexyl]but-3-en-2-yl]oxyoxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(E,2S)-4-[(1R,2R,4S)-1,2,4-trihydroxy-2,6,6-trimethylcyclohexyl]but-3-en-2-yl]oxyoxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(1R,3S,6S)-1,5,5-trimethyl-6-[(E,3S)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybut-1-enyl]-7-oxabicyclo[4.1.0]heptan-3-yl]oxy]oxane-3,4,5-triol | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-(4-((2S,3R)-3-(hydroxymethyl)-5-((E)-3-hydroxyprop-1-enyl)-7-methoxy-2,3-dihydro-1-benzofuran-2-yl)-2-methoxyphenoxy)oxane-3,4,5-triol | present | LOTUS | |
| (4S)-3-(hydroxymethyl)-5,5-dimethyl-4-[(E,3S)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybut-1-enyl]cyclohex-2-en-1-one | present | LOTUS | |
| (6R,9S)-3-Oxo-alpha-ionol glucoside | present | LOTUS | |
| 5-O-Caffeoylshikimic acid | present | LOTUS | |
| 7R,8S-Guaiacylglycerol-8-O-4'-(Coniferyl Alcohol)Ether | present | LOTUS | |
| Cholesterol | present | LOTUS |
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Equisetum ramosissimum has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes7
GenBank sequences10
eDNA detections11
Countries7
The DNA barcodea real sequence read deposited for this species
CTATCAACTTTCGATGGTAGGATAGAGGCCTACCATGGTGGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGA …
Equisetum ramosissimum isolate BPTPS056 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL8★rbcLa★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Equisetum ramosissimum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size27 481 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Equisetum ramosissimum27.48 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 216 n = 108
Chromosome records216–2162n range216median216mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2167×CCDB · nw-europe-fl · CCDB · book-ipcn72 · CCDB · book-LoveLove1977 +2
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1459
CCDB · book-ipcn72 — LOEVE, A., & E. KJELLQVIST. 1972. Cytotaxonomy of Spanish plants. I. Introduction. Pteridophyta and Gymnospermae. Lagascalia 2: 23-35.
CCDB · book-LoveLove1977 — Mehra & Bir 1959
CCDB · book-LoveLove1977 — Bir 1960b
CCDB · book-LoveLove1977 — Love & Kjellqvist 1972
CCDB · eflora
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 1081×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Vasudeva, S. M. & S. S. Bir. 1983. Chromosome numbers and evolutionary status of ferns and fern allies of Pachmarhi Hills (Central India).In: S. S. Bir (editor), Pteridophytes: their morphology, cytology, taxonomy and phylogeny. Aspects Pl. Sci. 6: 119–181.
08Occurrence & distribution
Record type35 422 records
Wild obs. + sensor27 690
Museum / vouchered7 171
Other561
Origin
Native2 576
Introduced13
Range
Area of Occupancy AOO58 940 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy37% within 1 km
≤100 m 3 704≤1 km 4 440≤10 km 13 525>10 km 290
21 959 georeferenced · 5 731 without coordinates
Open the mapobservation + sensor27 690
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 220≤1 km 610≤10 km 839>10 km 38
1 707 georeferenced · 5 464 without coordinates
Open the institutions mapphysical evidence7 171
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions113 of 223 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 863 |
| Beijing, CN | 448 |
| València, ES | 287 |
| MAlocation not on record | 283 |
| Moscow State Universitylocation not on record | 279 |
| LDlocation not on record | 246 |
| Yangling, CN | 214 |
| Odawara, JP | 201 |
| Barcelona, ES | 175 |
| Berlin, DE | 169 |
| Nanjing, CN | 156 |
| Zürich, CH | 129 |
| Vitoria, ES | 104 |
| BDBClocation not on record | 103 |
| Wlocation not on record | 98 |
| Zürich, CH | 89 |
| San Sebastián, ES | 83 |
| Urumqi, CN | 76 |
| Uniwersytet Wrocławskilocation not on record | 76 |
| EEZA-CSIClocation not on record | 74 |
| Guangzhou, CN | 72 |
| BFLlocation not on record | 71 |
| Salamanca, ES | 68 |
| Entomological Society of Latvialocation not on record | 65 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 62 |
| Osaka, JP | 59 |
| Granada, ES | 58 |
| Saint Louis, US | 52 |
| Bern, CH | 52 |
| BRNUlocation not on record | 51 |
| BClocation not on record | 49 |
| GMBAlocation not on record | 48 |
| GJOlocation not on record | 45 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 45 |
| Toyama, JP | 44 |
| Xining, CN | 43 |
| Bando, JP | 43 |
| Kunming, CN | 41 |
| Santiago de Compostela, ES | 41 |
| Sanda, JP | 40 |
| Tomioka, JP | 38 |
| Madrid, ES | 37 |
| South Kensington, GB | 37 |
| Chicago, US | 36 |
| Philadelphia, US | 36 |
| ISAlocation not on record | 36 |
| Xian, CN | 34 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 34 |
| Cape Town, ZA | 33 |
| College of the Atlantic, Museumlocation not on record | 32 |
| Mlocation not on record | 32 |
| Taipei, TW | 31 |
| Kochi, JP | 31 |
| Chengdu, CN | 30 |
| PRClocation not on record | 29 |
| Chiba, JP | 28 |
| Paris, FR | 28 |
| Durban, ZA | 26 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 25 |
| CICYTEXlocation not on record | 25 |
| Sendai, JP | 24 |
| Yunnan Universitylocation not on record | 23 |
| Dresden, DE | 23 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 22 |
| Córdoba, ES | 22 |
| TAIElocation not on record | 21 |
| Alicante, ES | 21 |
| Adam Mickiewicz University in Poznańlocation not on record | 21 |
| Badajoz, ES | 21 |
| Hangzhou, CN | 21 |
| Jiangxi Universitylocation not on record | 20 |
| Olocation not on record | 19 |
| CJBGlocation not on record | 18 |
| Chengdu, CN | 18 |
| Provincia di Livornolocation not on record | 18 |
| MeiseBGlocation not on record | 18 |
| Pamplona, ES | 17 |
| National Institute of Biological Resourceslocation not on record | 17 |
| GZUlocation not on record | 17 |
| Taipei, TW | 16 |
| Shinshu Universitylocation not on record | 16 |
| Beijing Normal Universitylocation not on record | 16 |
| Guiyang, CN | 15 |
| Plocation not on record | 15 |
| Phyletisches Museum Jenalocation not on record | 15 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 14 |
| Urumqi, CN | 14 |
| Salzburg, AT | 14 |
| Institute of Biology Ufa Scientific Centre of Russian Academy of Scienceslocation not on record | 13 |
| NSMKlocation not on record | 13 |
| Sevilla, ES | 13 |
| Minia, EG | 13 |
| KOMlocation not on record | 12 |
| Jaén, ES | 12 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 11 |
| Sagamihara, JP | 11 |
| Awka, NG | 11 |
| Fukushima Universitylocation not on record | 10 |
| Museo Achille Folettolocation not on record | 10 |
| UIBlocation not on record | 10 |
| Xinxiang, CN | 9 |
| Tianjin Natural History Museumlocation not on record | 9 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 9 |
| PrivatHerblocation not on record | 9 |
| Seoul, KR | 9 |
| Oskarshamn, SE | 9 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| Nijmegen, NL | 9 |
| Görlitz, DE | 9 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 8 |
| Lausanne, CH | 8 |
| SCAUlocation not on record | 7 |
| Uniwersytet Warszawskilocation not on record | 7 |
| KR | 7 |
| University of Stellenboschlocation not on record | 7 |
| H-Adlerlocation not on record | 7 |
| Auckland, NZ | 7 |
| Frankfurt am Main | 7 |
| Nagano City, JP | 7 |
| Guilin, CN | 6 |
| Dehra Dun, IN | 6 |
| WNNUlocation not on record | 6 |
| Wuhan, CN | 6 |
| Beijing, CN | 6 |
| Bourges, FR | 6 |
| Shanghai, CN | 6 |
| Shanxi Universitylocation not on record | 6 |
| Pamplona, ES | 6 |
| Tilburg, NL | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| KIWElocation not on record | 5 |
| Jiangxi College of Educationlocation not on record | 5 |
| Wuhan, CN | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| Tokushima, JP | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| Ischia Marine Centrelocation not on record | 4 |
| University of Silesia in Katowicelocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Stockholm, SE | 4 |
| Nanjing, CN | 4 |
| Zhejiang Universitylocation not on record | 4 |
| Edinburgh, GB | 4 |
| Central China Normal Universitylocation not on record | 4 |
| Chelyabinsk State Universitylocation not on record | 4 |
| Pretoria, ZA | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| The Maharaja Sayajirao University of Barodalocation not on record | 4 |
| WTUlocation not on record | 3 |
| Bronx, US | 3 |
| GZFlocation not on record | 3 |
| Wellington, NZ | 3 |
| Ann Arbor, US | 3 |
| Kyoto Universitylocation not on record | 3 |
| Institute of Plant and Animal Ecology Ural Branch of the Russian Academy of Scienceslocation not on record | 3 |
| nlocation not on record | 3 |
| Banyoles, ES | 3 |
| Guangzhou, CN | 3 |
| Frauenfeld, CH | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Inner Mongolia Universitylocation not on record | 3 |
| Instituto de Investigação Científica Tropicallocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| ENHMlocation not on record | 2 |
| Chongqing Natural History Museumlocation not on record | 2 |
| Bloomington, US | 2 |
| JBSlocation not on record | 2 |
| Philadelphia, US | 2 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 2 |
| Corvallis, US | 2 |
| University of Johannesburglocation not on record | 2 |
| Kew, GB | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Gijón, ES | 2 |
| BJUlocation not on record | 2 |
| Xiangtan City, CN | 2 |
| Hunan Geological Museumlocation not on record | 2 |
| FJIDClocation not on record | 2 |
| Jena Microbial Resource Collectionlocation not on record | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| Uppsala, SE | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| University of Calgarylocation not on record | 2 |
| Porrentruy, CH | 2 |
| Calabar, NG | 1 |
| Glocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Montréal, CA | 1 |
| Honolulu, US | 1 |
| Chapel Hill, US | 1 |
| Guiyang, CN | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Victoria, CA | 1 |
| LfUlocation not on record | 1 |
| Xiamen, CN | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Winterthur, CH | 1 |
| Trondheim, NO | 1 |
| IFR-DNFlocation not on record | 1 |
| FJFClocation not on record | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| University of Salzburglocation not on record | 1 |
| Zhengzhou, CN | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Santa Barbara, US | 1 |
| Oulu, FI | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Sion, CH | 1 |
| BG-NMNHSlocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| St. Paul, US | 1 |
| Monastir, TN | 1 |
| Durham, US | 1 |
| Chengdu, CN | 1 |
| No collectionlocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Kagoshima, JP | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Vancouver, CA | 1 |
| Wuzhou, CN | 1 |
223 institutions · 6 916 of 7 171 vouchered records shown · 245 without an institution code
09Environmental DNA11 detections
Where the DNA of Equisetum ramosissimum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map4 countries0
sandy steppes and pastures
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.8 °C 9.50–24.5
Seasonal swing summer↔winter9.90 °C
Max temp (day)21.5 °C 12.6–29.0
Min temp (night)14.8 °C 4.60–19.2
Precipitation94.2 mm/mo 22.8–235
Air humidity59.5 % 57.8–62.8
Moisture balance-46.1 mm/mo -112–110
Vapour deficit826 Pa 512–1,246
Wind speed3.10 m/s 2.80–4.40
Cloud cover42.4 % 36.7–49.4
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.