Equisetum hyemale
speciesAt a glance
Occurrence records79 042
Data sources16
Biological traits30
DNA specimens69
eDNA detections57
Sources16 archives
Databases and archives Equisetum hyemale's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility79 042 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI57 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics69 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources30 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS152 compounds
Occurrence & distributionGBIF79 042 records
Environmental DNA2 datasets · 7 countries57 detections
DNA & barcodingBOLD · NCBI69 specimens
Genome at a glanceCCDB · GoaT29.7 Gbp
01Narrative
Equisetum hyemale (commonly known as rough horsetail, scouring rush, scouringrush horsetail and, in South Africa, as snake grass) is a perennial herbaceous vascular plant in the horsetail family Equisetaceae. It is a native plant throughout the Holarctic Kingdom, found in North America, Europe, and northern Asia.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology6
Leaf mass456 mg
Leaf size1 380 mm²
Plant height0.95 m
⚠ sources differ — GIFT: 0.95 m · LEDA: 0.95 m · TRY: 0.445 m
Plant height generative0.95 m
Plant height max1 m
Plant height min0.25 m
Life cycle & reproduction7
Deciduousnessevergreen
Dispersal type detailedanemochorous
Flowering endAug
Flowering startJul
Life formrhizomatous geophyte
Life spanperennial
Raunkiær life formcryptophyte
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment7
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: lycophyte · TRY: Forb/herb
Mycorrhiza typenon-mycorrhizal
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio20.43 g/g
Leaf c314 mg/g
Leaf dry-matter content (LDMC)296 mg/g
⚠ sources differ — TRY: 296 mg/g · LEDA: 154 mg/g
Leaf n16.8 mg/g
Leaf p2.04 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)4.59 mm²/mg
⚠ sources differ — TRY: 4.59 mm²/mg · LEDA: 2.88 mm²/mg · GIFT: 2.88 mm²/mg
Other traits1
Diaspore typespore
03Chemical composition152 compounds
Compounds documented for Equisetum hyemale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Taxane diterpenoids11
Flavonols11
Carotenoids (C40, β-β)10
Cinnamic acids and derivatives9
Abeotaxane diterpenoids $ Taxane diterpenoids5
Documented compounds152 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| CALCIUM | 15,500 ppm | DukesPhytochem | |
| POTASSIUM | 14,900 ppm | DukesPhytochem | |
| MAGNESIUM | 1,010 ppm | DukesPhytochem | |
| IRON | 140 ppm | DukesPhytochem | |
| SODIUM | 85 ppm | DukesPhytochem | |
| MANGANESE | 12 ppm | DukesPhytochem | |
| ZINC | 10 ppm | DukesPhytochem | |
| COPPER | 4 ppm | DukesPhytochem | |
| ARSENIC | 0.12 ppm | DukesPhytochem |
05DNA & barcoding69 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Equisetum hyemale has left across the world's sequence archives.
At a glance
DNA specimens69
Marker genes7
GenBank sequences10
eDNA detections57
Countries7
The DNA barcodea real sequence read deposited for this species
AGCACTATTGGAACGCGCATTGCCTGAGACTCCCCCGCAAGGGGGAACGCGAAAAAACGAGAACGACTCTCGGCAACGGATATCTTGGCT …
Equisetum hyemale voucher KS23 HER0551 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★trnL★ITS1★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Equisetum hyemale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size29 740 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Equisetum hyemale29.74 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 216 n = 108
Ploidy2× diploid · measured
Chromosome records216–2162n range216median216mode10records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 21610×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl +5
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1456
CCDB · fl-europaea — Lttve 5 Love, 1961c
CCDB · ipcn-api-dl — Bennert, W., M. Lubienski, S. Körner & M. Steinberg. 2005. Triploidy in Equisetum subgenus Hippochaete (Equisetaceae, Pteridophyta). Ann. Bot. (Oxford) 95: 807–815.
CCDB · book-LoveLove1977 — Wagner, Farrar & McAlpin 1970
CCDB · book-LoveLove1977 — Love & Love (in Love 1976)
CCDB · eflora
CCDB · CromoCat 2015 — Bennert, W., Lubienski, M., Körner, S. & Steinberg, M. (2005). Triploidy in Equisetum subgenus Hippochaete (Equisetaceae, Pteridophyta) Ann. Bot. (Oxford) 95: 807–815
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
07Deep time~8.78 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin8.78 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type79 042 records
Wild obs. + sensor67 565
Museum / vouchered11 271
Cultivated / captive13
Fossil11
Other182
Origin
Native1 565
Introduced54
Range
Area of Occupancy AOO147 740 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 25 979≤1 km 8 003≤10 km 20 916>10 km 1 135
56 033 georeferenced · 11 532 without coordinates
Open the mapobservation + sensor67 565
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 1 116≤1 km 2 089≤10 km 2 338>10 km 985
6 528 georeferenced · 4 743 without coordinates
Open the institutions mapphysical evidence11 271
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 3>10 km 9
12 georeferenced · 1 without coordinates
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions255 of 456 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 773 |
| Helsinki, FI | 701 |
| LDlocation not on record | 416 |
| Moscow State Universitylocation not on record | 398 |
| Trondheim, NO | 370 |
| Philadelphia, US | 351 |
| Oulu, FI | 278 |
| Uniwersytet Wrocławskilocation not on record | 238 |
| BFLlocation not on record | 225 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 200 |
| Tartu, EE | 194 |
| MeiseBGlocation not on record | 183 |
| Chicago, US | 163 |
| TROMlocation not on record | 143 |
| Ann Arbor, US | 142 |
| Turku, FI | 119 |
| Salzburg, AT | 116 |
| MAlocation not on record | 105 |
| KMNlocation not on record | 99 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 98 |
| Bergen, NO | 96 |
| SLU Artdatabankenlocation not on record | 95 |
| Oskarshamn, SE | 92 |
| Garðabær, IS | 91 |
| Beijing, CN | 91 |
| Institute of Plant and Animal Ecology Ural Branch of the Russian Academy of Scienceslocation not on record | 90 |
| Knoxville, US | 90 |
| Minia, EG | 87 |
| Victoria, CA | 78 |
| Bern, CH | 78 |
| València, ES | 72 |
| BIO-UNIPIlocation not on record | 71 |
| Pullman, US | 67 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| Tacoma, US | 64 |
| WTUlocation not on record | 64 |
| Chapel Hill, US | 62 |
| Green Bay, US | 59 |
| Provincia di Livornolocation not on record | 55 |
| Vancouver, CA | 54 |
| Odawara, JP | 53 |
| Irkutsk State Universitylocation not on record | 53 |
| University of New Hampshirelocation not on record | 51 |
| TUR-Alocation not on record | 50 |
| Yangling, CN | 50 |
| Brookings, US | 49 |
| Bronx, US | 49 |
| Shinshu Universitylocation not on record | 46 |
| Udmurt State Universitylocation not on record | 44 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 41 |
| Santa Barbara, US | 40 |
| Tallinn, EE | 40 |
| Christchurch, NZ | 40 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 40 |
| Boise, US | 37 |
| Missoula, US | 37 |
| Toronto, CA | 36 |
| Phoenix, US | 35 |
| Tampere, FI | 35 |
| Nanjing, CN | 35 |
| 32 | |
| Görlitz, DE | 32 |
| Chongqing Museumlocation not on record | 32 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 31 |
| Vitoria, ES | 31 |
| Tyumen State Universitylocation not on record | 31 |
| Flagstaff, US | 31 |
| Québec, CA | 30 |
| University of Silesia in Katowicelocation not on record | 30 |
| WINlocation not on record | 29 |
| Moscow, US | 29 |
| Jyväskylä, FI | 29 |
| Wellington, NZ | 28 |
| Wlocation not on record | 27 |
| Fort Worth, US | 27 |
| Barcelona, ES | 26 |
| South Kensington, GB | 26 |
| Entomological Society of Latvialocation not on record | 26 |
| McWane Science Centerlocation not on record | 25 |
| University of Alberta Museumslocation not on record | 25 |
| Wuhan, CN | 25 |
| Kuopio, FI | 24 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 24 |
| Bando, JP | 24 |
| Uppsala, SE | 24 |
| Bangkok, TH | 24 |
| Logan, US | 23 |
| BDBClocation not on record | 23 |
| ASUlocation not on record | 23 |
| Saint John, CA | 22 |
| Morgantown, US | 22 |
| Dresden, DE | 22 |
| Corvallis, US | 22 |
| Salamanca, ES | 21 |
| Berlin, DE | 21 |
| Millersville, US | 21 |
| Williamsburg, US | 21 |
| Bozeman, US | 20 |
| Uniwersytet Warszawskilocation not on record | 20 |
| Provo, US | 20 |
| Chengdu, CN | 20 |
| SZUlocation not on record | 20 |
| Tuscaloosa, US | 20 |
| Columbia, US | 20 |
| Madison, US | 20 |
| Urumqi, CN | 20 |
| Allentown, US | 20 |
| Toyama, JP | 19 |
| Staten Island, US | 19 |
| Montréal, CA | 19 |
| Xian, CN | 19 |
| Riverside, US | 19 |
| Durango, MX | 19 |
| GJOlocation not on record | 18 |
| Guangzhou, CN | 18 |
| 东北师范大学自然博物馆location not on record | 17 |
| Nijmegen, NL | 17 |
| BAYLUlocation not on record | 17 |
| Auckland, NZ | 17 |
| Saint Louis, US | 17 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 16 |
| Granada, ES | 16 |
| Lincoln, US | 16 |
| NMBU:MINAlocation not on record | 15 |
| EL PASO, US | 15 |
| BClocation not on record | 15 |
| Pontifícia Universidade Católica do Paranálocation not on record | 15 |
| KR | 15 |
| Portland, US | 14 |
| Madrid, ES | 14 |
| nbflocation not on record | 14 |
| BSBIlocation not on record | 14 |
| Sanda, JP | 14 |
| San Sebastián, ES | 13 |
| National Institute of Biological Resourceslocation not on record | 13 |
| Austin, US | 13 |
| San Luis Obispo, US | 13 |
| DBF-NHMDlocation not on record | 13 |
| Dekalb, US | 13 |
| Tampa, US | 13 |
| St. Paul, US | 13 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 13 |
| Trois-Rivières, CA | 13 |
| Santiago de Compostela, ES | 13 |
| Institute of Biology Ufa Scientific Centre of Russian Academy of Scienceslocation not on record | 12 |
| LfUlocation not on record | 12 |
| KIRMlocation not on record | 12 |
| Sendai, JP | 12 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 12 |
| UGentlocation not on record | 12 |
| Jurica-Suchy Nature Museumlocation not on record | 12 |
| Tuxtla Gutiérrez, MX | 12 |
| US | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| Porrentruy, CH | 11 |
| Cheney, US | 11 |
| Mount Pleasant, US | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 11 |
| Cincinnati, US | 11 |
| Iwate Prefectural Museumlocation not on record | 11 |
| Montréal, CA | 10 |
| Spearfish, US | 10 |
| Pocatello, US | 10 |
| WNNUlocation not on record | 10 |
| Wuhan, CN | 10 |
| Rovaniemi, FI | 10 |
| NSMKlocation not on record | 10 |
| Alicante, ES | 10 |
| Miami, US | 10 |
| Burlington, US | 9 |
| Albuquerque, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Acadia Universitylocation not on record | 9 |
| San Angelo, US | 8 |
| USFS/BHSClocation not on record | 8 |
| Canberra, AU | 8 |
| Natural History Museum Rotterdamlocation not on record | 8 |
| Forssa, FI | 8 |
| Mlocation not on record | 8 |
| Hobart, AU | 8 |
| PrivatHerblocation not on record | 8 |
| Texas A&M Universitylocation not on record | 8 |
| Claremont, US | 8 |
| GZUlocation not on record | 8 |
| Appalachian State Universitylocation not on record | 8 |
| Whitewater, US | 8 |
| Central China Normal Universitylocation not on record | 8 |
| Frauenfeld, CH | 7 |
| CJBGlocation not on record | 7 |
| Mexico City, MX | 7 |
| Tomioka, JP | 7 |
| Frankfurt am Main | 7 |
| Tilburg, NL | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Philadelphia, US | 7 |
| Xining, CN | 7 |
| Blumenau, BR | 6 |
| Mount Annan, AU | 6 |
| Bourges, FR | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Nagano City, JP | 6 |
| Hudson, US | 6 |
| CASlocation not on record | 6 |
| Urumqi, CN | 6 |
| Stockholm, SE | 6 |
| Brussel, BE | 6 |
| Porvoo, FI | 6 |
| University of Stellenboschlocation not on record | 6 |
| Salvador, BR | 5 |
| Glarus, CH | 5 |
| Chelyabinsk State Universitylocation not on record | 5 |
| Naturalis Biodiversity Centerlocation not on record | 5 |
| Lubbock, US | 5 |
| Davenport, US | 5 |
| University of Tennessee at Chattanoogalocation not on record | 5 |
| PRClocation not on record | 5 |
| Kyoto Universitylocation not on record | 5 |
| Kunming, CN | 5 |
| Guiyang, CN | 5 |
| Kandalaksha State Nature Reservelocation not on record | 5 |
| Tuxtla Gutiérrez, MX | 5 |
| BRNUlocation not on record | 5 |
| No collectionlocation not on record | 5 |
| Norfolk, US | 4 |
| 云南省思茅市民族传统医药研究所location not on record | 4 |
| Paris, FR | 4 |
| CONCOLlocation not on record | 4 |
| University of Winnipeglocation not on record | 4 |
| Henderson, US | 4 |
| Long Beach, US | 4 |
| New Haven, US | 4 |
| AUAlocation not on record | 4 |
| Osaka, JP | 4 |
| US | 4 |
| Denver, US | 4 |
| Lake Charles, US | 4 |
| UFPRlocation not on record | 4 |
| Museo Entomologico de Leonlocation not on record | 4 |
| China Agricultural Universitylocation not on record | 4 |
| Taipei, TW | 4 |
| Toyota city nature sanctuarylocation not on record | 4 |
| University of Lethbridgelocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Chengdu, CN | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| IPDNlocation not on record | 4 |
| Weber State Universitylocation not on record | 3 |
| Waverly, US | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| Nanchong, CN | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| New Brunswick, US | 3 |
| Orem, US | 3 |
| Sion, CH | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Angwin, US | 3 |
| Museo Achille Folettolocation not on record | 3 |
| Mississippi State, US | 3 |
| University of Wisconsinlocation not on record | 3 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 3 |
| EEZA-CSIClocation not on record | 3 |
| Caldwell, US | 3 |
| Tromso University Museumlocation not on record | 3 |
| H-Meierottlocation not on record | 3 |
| Dhaka, BD | 3 |
| Chengdu, CN | 3 |
| Zhengzhou, CN | 3 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Philadelphia, US | 3 |
| Tlalnepantla, MX | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Foz do Iguaçu, BR | 3 |
| Fredericton Stock Culture Collectionlocation not on record | 3 |
| Durham, US | 3 |
| Chiba, JP | 3 |
| JBRJlocation not on record | 3 |
| Walla Walla, US | 3 |
| Cenargenlocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Guatemala City, GT | 2 |
| Kushiro City Museumlocation not on record | 2 |
| Edinburgh, GB | 2 |
| Podgorica, ME | 2 |
| BG-NMNHSlocation not on record | 2 |
| Karlsruhe, DE | 2 |
| Ciudad de México, MX | 2 |
| Ivano-Frankove, UA | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Kensington, AU | 2 |
| Mexico City, MX | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| UnBlocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| UFBAlocation not on record | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| Richmond, US | 2 |
| IDElocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Kingston, US | 2 |
| Minot State Universitylocation not on record | 2 |
| KURAlocation not on record | 2 |
| Stephenville, US | 2 |
| USFSlocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| Clemson, US | 2 |
| US | 2 |
| INMAlocation not on record | 2 |
| Hokkaido University Museumlocation not on record | 2 |
| Pelotas, BR | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Santa Teresa, BR | 2 |
| Bend, US | 2 |
| Winterthur, CH | 2 |
| Sagamihara, JP | 2 |
| Seoul, KR | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Jaén, ES | 2 |
| UFVJMlocation not on record | 2 |
| Hermosillo, MX | 2 |
| Fredericksburg, US | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| Hangzhou, CN | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Conway, US | 2 |
| Northridge, US | 2 |
| Yunnan Universitylocation not on record | 2 |
| Guilin, CN | 2 |
| Fullerton, US | 2 |
| Denton, US | 2 |
| Zürich, CH | 2 |
| Pittsburg, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Cambridge, US | 1 |
| University of Salzburglocation not on record | 1 |
| Rotorua, NZ | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Seropédica, BR | 1 |
| BJUlocation not on record | 1 |
| SXPHClocation not on record | 1 |
| Criciúma, BR | 1 |
| Batemans Bay, AU | 1 |
| H-Hohlalocation not on record | 1 |
| UEMlocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| Russellville, US | 1 |
| Gijón, ES | 1 |
| Irvine, US | 1 |
| University of New Englandlocation not on record | 1 |
| Whitehorse, CA | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Tapachula, MX | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Guasave, MX | 1 |
| GB | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| UFRPElocation not on record | 1 |
| US | 1 |
| Armidale, AU | 1 |
| Uberlândia, BR | 1 |
| CICYTEXlocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| UNIVASFlocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Ashland, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Kochi, JP | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Taipei, TW | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Blacksburg, US | 1 |
| BGBMlocation not on record | 1 |
| Washington, US | 1 |
| Pamplona, ES | 1 |
| JMSlocation not on record | 1 |
| Naturkundliche Sammlung Urilocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Portland, US | 1 |
| Lausanne, CH | 1 |
| UNIVILLElocation not on record | 1 |
| Cascavel, BR | 1 |
| Fargo, US | 1 |
| Bothell, US | 1 |
| KOMlocation not on record | 1 |
| Chicago, US | 1 |
| UFRRJlocation not on record | 1 |
| Xiamen, CN | 1 |
| Brasília, BR | 1 |
| Truckee, US | 1 |
| JP | 1 |
| 中国极地研究中心location not on record | 1 |
| HUENFlocation not on record | 1 |
| Santa Maria, BR | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Ypsilanti, US | 1 |
| Pamplona, ES | 1 |
| UFESlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Namur, BE | 1 |
| Bloomington, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| GAlocation not on record | 1 |
| VALElocation not on record | 1 |
| Mexico City, MX | 1 |
| H-Schuhwlocation not on record | 1 |
| Durham, US | 1 |
| Kew, GB | 1 |
| Tokushima, JP | 1 |
| Grand Junction, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| UNESClocation not on record | 1 |
| Fukushima Universitylocation not on record | 1 |
| Macomb, US | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Edmonton, CA | 1 |
| H-Adlerlocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Johnson City, US | 1 |
| College Park, US | 1 |
| Santa Cruz, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| San Diego, US | 1 |
| Davis, US | 1 |
| Decorah, US | 1 |
| Toluca, MX | 1 |
| The University of Arizonalocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Tsitsin Main Botanical Garden Russian Academy of Scienceslocation not on record | 1 |
| Fulda, DE | 1 |
| Siberian forest experimental stationlocation not on record | 1 |
| Anchorage, US | 1 |
| UNESP-RClocation not on record | 1 |
| Madrid, ES | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| UFSClocation not on record | 1 |
| Monastir, TN | 1 |
| Turlock, US | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
456 institutions · 10 490 of 11 271 vouchered records shown · 648 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA57 detections
Where the DNA of Equisetum hyemale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found57
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 57 detections have coordinates
Open the map7 countries0
Between thicket swamp, old field and outflow…decidous forest along river
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 9.40–18.6
Seasonal swing summer↔winter22.2 °C
Max temp (day)18.1 °C 12.6–23.1
Min temp (night)12.2 °C 5.70–16.2
Precipitation81.6 mm/mo 72.5–106
Air humidity60.7 % 58.8–63.8
Moisture balance-13.1 mm/mo
Vapour deficit683 Pa 474–897
Wind speed3.90 m/s
Cloud cover42.1 % 37.9–63.6
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.