Equilabium laxiflorum

(Benth.) Mwany., A.J.Paton & Culham · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Equilabium

At a glance

Occurrence records324

Data sources6

Biological traits16

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Equilabium laxiflorum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility324 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Occurrence & distributionGBIF324 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Plectranthus fraternus là một loài thực vật có hoa trong họ Hoa môi. Loài này được T.C.E.Fr. miêu tả khoa học đầu tiên năm 1930.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology5

Plant height max1.5 m

Plant height min0.69 m

Seed mass0.916 mg

Seed mass max0.94 mg

Seed mass min0.94 mg

Life cycle & reproduction2

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberfacultative

Elevation max1 980 m

Elevation min15 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Equilabium laxiflorum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON950978.1 ↗755 bpKenya · 2014

ACGT

ATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAG …

Equilabium laxiflorum voucher PE CPG29229 Z.D. Chen et al. 29229 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Equilabium laxiflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · Cave1958

CCDB · Cave1958 — de Wet 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type324 records

Wild obs. + sensor262

Museum / vouchered62

Range

Area of Occupancy AOO824 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 158≤1 km 33≤10 km 5>10 km 7

203 georeferenced · 59 without coordinates

Open the mapobservation + sensor262

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 62 records without

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	52
MeiseBGlocation not on record	5
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Saint Louis, US	1

4 institutions · 59 of 62 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)