Eptatretus stoutii

(Lockington, 1878) · species

image placeholder — illustration coming later

Animalia/Chordata/Myxini/Myxiniformes/Myxinidae/Eptatretus

At a glance

Occurrence records984

Data sources10

Biological traits7

DNA specimens12

eDNA detections11

Sources10 archives

Databases and archives Eptatretus stoutii's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility570 records↗

OBISOcean Biodiversity Information System414 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS984 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT2.7 Gbp

01Narrative

The Pacific hagfish (Eptatretus stoutii) is a species of hagfish. It lives in the mesopelagic to abyssal Pacific ocean, near the ocean floor. It is a jawless fish and has a body plan that resembles early paleozoic fish. They are able to excrete prodigious amounts of slime in self-defense.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length63.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits3

Depth max966 m

Depth min16 m

Vulnerability45.4

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eptatretus stoutii has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

238Amostly conserved

244Cmostly conserved

256Cmostly conserved

268Cmostly conserved

306Gmostly conserved

544Cmostly conserved

610Cmostly conserved

613Tmostly conserved

CCTTTATCTAATTTTTGGTGCATGAGCCGGAATAATCGGAACAGCTTTAAGTGTAATTATTCGAACAGAATTAAGCCAACCAGGGCCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes3

BIN1

Most divergent pair0.77%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eptatretus atamisame genus4.3%Eptatretus wadgensissame genus4.7%Eptatretus deanisame genus4.9%Eptatretus walkerisame genus6.7%Eptatretus burgerisame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Eptatretus stoutii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 669 940 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Eptatretus stoutii2.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Chromosome records48–482n range48median48mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 482×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

08Occurrence & distribution

Record type984 records

Wild obs. + sensor606

Museum / vouchered378

Origin

Native35

Range

Area of Occupancy AOO1 512 km²

Depth

0–200 m sunlit43

200–1000 m twilight127

1–4 km midnight4

>4 km abyssal0

median 782.6 m · max 1 042 m · 174 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 180≤1 km 5≤10 km 3

188 georeferenced · 418 without coordinates

Open the mapobservation + sensor606

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 14≤1 km 11≤10 km 36>10 km 16

77 georeferenced · 301 without coordinates

Open the institutions mapphysical evidence378

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of California San Diegolocation not on record	107
CASlocation not on record	53
Los Angeles, US	26
Cambridge, US	15
Centro Interdisciplinario de Ciencias Marinas, Instituto Politécnico Nacionallocation not on record	12
Oregon State Universitylocation not on record	11
Vancouver, CA	10
UWFClocation not on record	9
Washington, US	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	8
Moore Laboratory of Zoology, Occidental Collegelocation not on record	7
Stockholm, SE	6
University of Alberta Museumslocation not on record	5
University of Victorialocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Toronto, CA	2
Edmonton, CA	2
Ann Arbor, US	2
Berkeley, US	1
Facultad de Ciencias Marinas, Universidad Autónoma de Baja Californialocation not on record	1
	1
University of Washingtonlocation not on record	1
New Haven, US	1
Chicago, US	1

24 institutions · 293 of 378 vouchered records shown · 6 without an institution code

09Environmental DNA11 detections

Where the DNA of Eptatretus stoutii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 7.70–13.9

Seasonal swing summer↔winter10.4 °C

Max temp (day)16.0 °C 10.8–16.0

Min temp (night)11.7 °C 4.40–12.5

Precipitation139 mm/mo 50.6–139

Air humidity65.4 % 60.9–65.4

Moisture balance12.8 mm/mo

Vapour deficit538 Pa 446–558

Wind speed2.70 m/s

Cloud cover37.1 % 35.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)