Epithele nikau — The Life Data

Fungi/Basidiomycota/Agaricomycetes/Polyporales/Polyporaceae/Epithele

At a glance

Occurrence records26

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Epithele nikau's data was compiled from.

GBIFGlobal Biodiversity Information Facility26 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF26 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epithele nikau has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMF061368.1 ↗216 bpFrench Guiana · 2008

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATC …

Epithele nikau voucher G1535 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS5

fungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor10

Museum / vouchered16

Range

Area of Occupancy AOO68 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 8

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 16 records without

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	12
EcoFoG FunGuy collectionlocation not on record	2

2 institutions · 14 of 16 vouchered records shown · 2 without an institution code