Epischura baicalensis

species

image placeholder — illustration coming later

Animalia/Arthropoda/Copepoda/Calanoida/Temoridae/Epischura

At a glance

Occurrence records1

Data sources4

Biological traits0

DNA specimens60

eDNA detections60

Sources4 archives

Databases and archives Epischura baicalensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics60 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF1 records

Environmental DNA1 datasets · 0 countries60 detections

DNA & barcodingBOLD60 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding60 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epischura baicalensis has left across the world's sequence archives.

At a glance

DNA specimens60

BINs1

Marker genes1

eDNA detections60

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P563 bp consensus60 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

108Amostly conserved

111Gmostly conserved

123Tmostly conserved

174Avariable

216Tmostly conserved

240Cmostly conserved

312Tmostly conserved

396Cmostly conserved

471Cmostly conserved

528Tmostly conserved

531Cmostly conserved

ATTATTCGAATGGAGCTGGGGCAAGCTGGAAGTTTAATTGGGGATGACCAAATTTACAATGTTGTAGTGACAGCACACGCCTTTATCATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 57 variants.

Diversity (π)0.94%

Haplotypes57

BIN1

Most divergent pair2.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Epischura chankensissame genus14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the institutions mapphysical evidence1

09Environmental DNA60 detections

Where the DNA of Epischura baicalensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)