Epinotia pygmaeana

(Hübner, 1796-1799) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Epinotia

At a glance

Occurrence records1 212

Data sources8

Biological traits2

DNA specimens25

eDNA detections79

Sources8 archives

Databases and archives Epinotia pygmaeana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 212 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 212 records

Environmental DNA3 datasets · 5 countries79 detections

DNA & barcodingBOLD25 specimens

Genome at a glanceGoaT · NCBI≈753 Mbp

01Narrative

Epinotia pygmaeana, the pygmy needle tortricid, is a moth of the family Tortricidae. It is found across the Palearctic from northern and central Europe to eastern Russia. The wingspan is 12–14 mm.The forewings are fuscous, whitish-sprinkled, costa spotted with dark fuscous ; basal patch with edge sharply angulated, and central fascia darker, space between them forming a subquadrate more whitish dorsal spot; ocellus large, broadly edged with leaden-metallic. Hindwings are white ; apical third fuscous, darker terminally.The larva is green ; spots black ; head and plate of 2 black.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing from late March to early June. The larvae feed on Picea abies, Picea excelsa, Picea sitchensis and Abies alba. The larvae mine and later spin the needles of their host, causing a decrease in growth.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epinotia pygmaeana has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections79

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAGTTGGTACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Epinotia nigralbanasame genus5.2%Epinotia wrightisame genus5.2%Epinotia granitanasame genus5.5%Epinotia subsequanasame genus5.6%Epinotia emarginanasame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Epinotia pygmaeana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈753 291 754 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Epinotia pygmaeana0.75 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.5% BUSCO

08Occurrence & distribution

Record type1 212 records

Wild obs. + sensor756

Museum / vouchered332

Other124

Range

Area of Occupancy AOO3 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 223≤1 km 303≤10 km 165>10 km 2

693 georeferenced · 63 without coordinates

Open the mapobservation + sensor756

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 71≤1 km 140≤10 km 60

271 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence332

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DanishLepidopterologicalSocietylocation not on record	88
Provincia di Livornolocation not on record	74
NHMOlocation not on record	42
Tartu, EE	22
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	19
SLU Artdatabankenlocation not on record	16
BioFokuslocation not on record	8
Salzburg, AT	4
Stockholm, SE	4
Rovaniemi, FI	4
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
NTNU-VMlocation not on record	2
Philadelphia, US	2
Natural History Museum Rotterdamlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
Nijmegen, NL	1
Tallinn, EE	1
Kuopio, FI	1
Museum für Naturkunde und Vorgeschichte Dessaulocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
Research Collection of Kai Berggrenlocation not on record	1
Research Collection of Alfred Haslbergerlocation not on record	1
neflocation not on record	1

23 institutions · 298 of 332 vouchered records shown · 34 without an institution code

09Environmental DNA79 detections

Where the DNA of Epinotia pygmaeana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys3

Countries5

Verifiable raw sequence linked56

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map5 countries0

Fen edge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.80 °C 4.10–12.7

Seasonal swing summer↔winter19.6 °C

Max temp (day)10.4 °C 6.90–16.1

Min temp (night)2.20 °C -0.8–7.50

Precipitation50.1 mm/mo 39.9–96.2

Air humidity59.5 % 56.8–60.7

Moisture balance-16.4 mm/mo -50.1–27.5

Vapour deficit375 Pa 326–601

Wind speed2.80 m/s 2.20–3.80

Cloud cover48.8 % 40.2–56.8

CHELSA 1981–2010, ~9 km grid, at location & month of 78 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epinotia pygmaeana

At a glance

Sources8 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 212 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 212 records