Epimedium pinnatum

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Berberidaceae/Epimedium

At a glance

Occurrence records138

Data sources8

Biological traits15

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Epimedium pinnatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility138 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF138 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 12

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height0.2 m

Plant height max0.5 m

Seed mass4.03 mg

Seed mass max4.03 mg

Seed mass min4.03 mg

Life cycle & reproduction5

Flowering endApr

Flowering startMar

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifespan years2 years

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTforest

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epimedium pinnatum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences8

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSEU525870.1 ↗633 bp

ACGT

TCAAAACCTGCAAAGCAGAACGACCAGCGAACTTGTGAAAAACACTTATGGGAGGGACGAAGGGTGCTAACCTTGAATCCTTCCTACTGG …

Epimedium pinnatum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epimedium pinnatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidydiploid inferred

Chromosome records12–122n range12median12mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 126×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — KOSENKO, V. N. 1979. Comparative karyological study of representatives of the family Berberidaceae s.l. Bot. Zhurn. 64 (11): 1539–1551. (In Russian).

CCDB · ipcn-api-dl — Takahashi, C. 1989. Karyomorphological studies on speciation of Epimedium and its allied Vancouveria with special reference to C-bands. J. Sci. Hiroshima Univ., Ser. B, Div. 2, Bot. 22: 159–269.

CCDB · book-fedorov — Litardiere 1921

CCDB · book-fedorov — Langlet 1928

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type138 records

Wild obs. + sensor129

Museum / vouchered8

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 54≤1 km 31≤10 km 16>10 km 1

102 georeferenced · 27 without coordinates

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 2

3 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence8

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	4
Dekalb, US	1
Olocation not on record	1
Winterthur, CH	1

4 institutions · 7 of 8 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Epimedium pinnatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)