Epimedium alpinum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Berberidaceae/Epimedium

At a glance

Occurrence records3 604

Data sources8

Biological traits25

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Epimedium alpinum's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 604 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF3 604 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT4 Gbp

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology6

Plant height0.25 m

⚠ sources differ — GIFT: 0.25 m · LEDA: 0.25 m · TRY: 0.29 m

Plant height generative0.25 m

Plant height max0.4 m

Plant height min0.06 m

Seed length4.53 mm

Seed mass4.67 mg

Life cycle & reproduction11

Dehiscencedehiscent

Dispersal typehuman

⚠ sources differ — LEDA: ethelochor · GIFT: unspecialized

Flowering endJul

Flowering startApr

Life formperennial or rhizomatous geophyte

Life spanperennial

⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial

Lifespan years3 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualabsent

Diet & foraging1

Carnivorynon-carnivorous

Habitat & environment5

Climatetemperate

Climberobligatory

Fruit typecapsule

Growth formherb

⚠ sources differ — GIFT: herb · TRY: climber

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epimedium alpinum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU525869.1 ↗633 bp

ACGT

TCAAAACCTGCAAAGCAGAACGACCAGCGAACTTGTGAAAAACACTTATGGGAGGGACGAAGGGTGCTAACCTTGAATCCTTCCTACTGG …

Epimedium alpinum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS4

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Epimedium alpinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 004 909 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Epimedium alpinum4 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Ploidy2× diploid · measured

Chromosome records12–122n range12median12mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 122×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type3 604 records

Wild obs. + sensor3 417

Museum / vouchered181

Cultivated / captive3

Other3

Origin

Introduced42

Range

Area of Occupancy AOO9 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 2 287≤1 km 97≤10 km 294>10 km 3

2 681 georeferenced · 736 without coordinates

Open the mapobservation + sensor3 417

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 28≤1 km 54≤10 km 22>10 km 4

108 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence181

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	49
Oskarshamn, SE	14
SLU Artdatabankenlocation not on record	12
Uppsala, SE	10
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	9
Provincia di Livornolocation not on record	8
Olocation not on record	7
Adam Mickiewicz University in Poznańlocation not on record	5
Mlocation not on record	5
LDlocation not on record	5
Bern, CH	5
South Kensington, GB	4
BRNUlocation not on record	4
GJOlocation not on record	3
KMNlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Winterthur, CH	2
DBF-NHMDlocation not on record	2
GZUlocation not on record	2
Wellington, NZ	2
Porrentruy, CH	2
Tampere, FI	1
Helsinki, FI	1
Auckland, NZ	1
H-Schuhwlocation not on record	1
Frankfurt am Main	1
Bourges, FR	1
BClocation not on record	1
Universität Göttingenlocation not on record	1
PRClocation not on record	1
Stockholm, SE	1
Vancouver, CA	1
Denver, US	1
Görlitz, DE	1

34 institutions · 167 of 181 vouchered records shown · 13 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Epimedium alpinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epimedium alpinum

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction11

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 604 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 604 records