Epilobium siskiyouense — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records216

Data sources9

Biological traits5

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Epilobium siskiyouense's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility216 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF216 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Epilobium siskiyouense is a rare species of flowering plant in the evening primrose family known by the common names Siskiyou willowherb and Siskiyou fireweed (though it is not a true fireweed).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Forb/herb

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium siskiyouense has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSL28032.1 ↗616 bp

ACGT

GTCGAATCCTGCATAGCAGAACAACCCGAGAACCGGTTAACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCT …

Epilobium sisikouyense internal transcribed spacer 1 and 2; 5.8S ribosomal RNA (5.8S rDNA) gene

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type216 records

Wild obs. + sensor149

Museum / vouchered67

Range

Area of Occupancy AOO552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 10≤1 km 3≤10 km 1>10 km 131

145 georeferenced · 4 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 3≤1 km 25≤10 km 17>10 km 5

50 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Arcata, US	11
Claremont, US	10
Davis, US	8
Chicago, US	6
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	6
Ashland, US	3
CASlocation not on record	2
STNFlocation not on record	2
Angwin, US	2
Pullman, US	2
Boise, US	1
US	1

12 institutions · 54 of 67 vouchered records shown · 13 without an institution code

09Environmental DNA1 detections

Where the DNA of Epilobium siskiyouense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.