Epilobium roseum
(Schreb.) Schreb. · speciesAt a glance
Occurrence records36 000
Data sources11
Biological traits43
DNA specimens19
eDNA detections8
Sources11 archives
Databases and archives Epilobium roseum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility36 000 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources43 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF36 000 records
Environmental DNA1 datasets · 3 countries8 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB · GoaT2n = 36
01Narrative
Epilobium roseum, l'épilobe à fleurs roses, encore appelée épilobe rosé, est une espèce de plantes à fleurs de la famille des Onagraceae. C'est une plante herbacée vivace trouvée de l'Europe à la Chine.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Leaf mass13.55 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 654 mm² · GIFT: 654 mm²
Plant height0.4 m
⚠ sources differ — GIFT: 0.4 m · LEDA: 0.425 m · TRY: 0.613 m
Plant height generative0.525 m
Plant height max0.9 m
Plant height min0.15 m
Seed length0.95 mm
Seed mass0.089 mg
Seed mass max0.09 mg
Seed mass min0.087 mg
Seed volume0.074 mm³
Seed volume max0.074 mm³
Seed volume min0.074 mm³
Life cycle & reproduction12
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flowering endSep
Flowering startJul
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTcanals, rivers
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)150 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)48.27 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Shoot orientationascending
03Chemical composition7 compounds
Compounds documented for Epilobium roseum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Gallotannins3
Flavonols3
Cinnamic acids and derivatives1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| [(10R,11S,12R,13R,15R)-3,4,5,13,21,22,23-heptahydroxy-8,18-dioxo-11-(3,4,5-trihydroxybenzoyl)oxy-9,14,17-trioxatetracyclo[17.4.0.02,7.010,15]tricosa-1(23),2,4,6,19,21-hexaen-12-yl] 2-[[(10S,11S,12R,13S,15R)-3,4,5,12,22,23-hexahydroxy-8,18-dioxo-11,13-bis[(3,4,5-trihydroxybenzoyl)oxy]-9,14,17-trioxatetracyclo[17.4.0.02,7.010,15]tricosa-1(23),2,4,6,19,21-hexaen-21-yl]oxy]-3,4,5-trihydroxybenzoate | present | LOTUS | |
| Ellagic acid | present | LOTUS | |
| Myricetin 3-glucoside | present | LOTUS | |
| Myricitrin | present | LOTUS | |
| Oenothein B | present | LOTUS | |
| Quercitrin | present | LOTUS | |
| trans-5-O-caffeoyl-D-quinate | present | LOTUS |
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium roseum has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes5
GenBank sequences7
eDNA detections8
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCAATCATC …
Epilobium roseum voucher NMW4343 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Epilobium roseum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidydiploid inferred
Chromosome records36–362n range36median36mode24records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3624×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Raven, P.H., Moore, D.M. Watsonia 6: 36-38 (1964)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3052
CCDB · fl-europaea — Raven 1S Moore,
CCDB · poland — Izmai?ow R. 1977. Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20, 101-111.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Chen, C., P. C. Hoch & P. H. Raven. 1992. Systematics of Epilobium (Onagraceae) in China. Syst. Bot. Monogr. 34: 1–209.
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-northern-plants — Michaelis 1925.
CCDB · book-indian_vol1 — Schwemmle, J. 1924; Michaelis, P. 1925; Tischler, G. 1934; Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov); Gagnieu, A. & Linder, R. 1954, 1955; Raven, P.H. & Moore, D.M. 1964; Hsu, C.-C. 1968; Jash, M. & Sharma, A. 1970
CCDB · eflora
CCDB · book-fedorov — Schwemmle 1924
CCDB · book-fedorov — Michaelis P. 1925
CCDB · book-fedorov — Tisch! er 1934
CCDB · book-fedorov — CoKoJIOBCKaH, CrpeJIKona 19486
CCDB · book-fedorov — Gagnieu, Linder 1954, 1955 (L. 1961)
CCDB · book-fedorov — Raven, Moore 1964
CCDB · CromoCat 2015 — Izmailow R. (1977). Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20(1-2): 101-111.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Pashuk, K. T. (1987). Chromosome number in species of subalpine belt of Chernogora (Ukrainian Carpathians). Bot. Žurn. 72(8): 1069-1074.
n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Chatterjee, A., S. Ghosh & S. C. Roy. 1989. A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22–29.
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.
CCDB · book-ipcn67-71 — HSU, C.-C. 1968. Preliminary chromosome studies on the vascular plants of Taiwan (II). Taiwania No. 14: 11-27.
CCDB · CromoCat 2015 — Chatterjee, A., Ghosh, S. & Roy, S. C. (1989). A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22-29.
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977a). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107-119.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type36 000 records
Wild obs. + sensor31 330
Museum / vouchered4 399
Cultivated / captive13
Other258
Origin
Native4 446
Introduced38
Range
Area of Occupancy AOO83 228 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy25% within 1 km
≤100 m 3 297≤1 km 3 346≤10 km 19 863>10 km 272
26 778 georeferenced · 4 552 without coordinates
Open the mapobservation + sensor31 330
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 939≤1 km 749≤10 km 876>10 km 279
2 843 georeferenced · 1 556 without coordinates
Open the institutions mapphysical evidence4 399
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 13
13 georeferenced
Open the mapnot free-living13
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions51 of 108 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| DBF-NHMDlocation not on record | 503 |
| Uniwersytet Wrocławskilocation not on record | 454 |
| LDlocation not on record | 439 |
| BRNUlocation not on record | 312 |
| SLU Artdatabankenlocation not on record | 308 |
| Helsinki, FI | 195 |
| Olocation not on record | 185 |
| Moscow State Universitylocation not on record | 179 |
| MeiseBGlocation not on record | 162 |
| Salzburg, AT | 99 |
| Tartu, EE | 99 |
| Provincia di Livornolocation not on record | 92 |
| Oskarshamn, SE | 90 |
| Görlitz, DE | 61 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 59 |
| Bergen, NO | 50 |
| Uppsala, SE | 48 |
| BFLlocation not on record | 46 |
| Turku, FI | 43 |
| Bern, CH | 42 |
| Tallinn, EE | 34 |
| South Kensington, GB | 29 |
| Podgorica, ME | 27 |
| Frankfurt am Main | 22 |
| Berlin, DE | 22 |
| GJOlocation not on record | 20 |
| TUR-Alocation not on record | 20 |
| Trondheim, NO | 19 |
| Mlocation not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Uniwersytet Jagiellońskilocation not on record | 17 |
| Oulu, FI | 17 |
| Dresden, DE | 16 |
| Uniwersytet Warszawskilocation not on record | 16 |
| Uniwersytet Śląski w Katowicachlocation not on record | 15 |
| Beijing, CN | 14 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 13 |
| NMBU:MINAlocation not on record | 11 |
| PrivatHerblocation not on record | 9 |
| PRClocation not on record | 9 |
| TROMlocation not on record | 8 |
| Wlocation not on record | 8 |
| Porrentruy, CH | 7 |
| CJBGlocation not on record | 7 |
| Karlsruhe, DE | 7 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 6 |
| Barcelona, ES | 6 |
| BClocation not on record | 6 |
| Jyväskylä, FI | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Kuopio, FI | 5 |
| BDBClocation not on record | 5 |
| KMNlocation not on record | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Winterthur, CH | 5 |
| Voronezh State Universitylocation not on record | 4 |
| Bourges, FR | 4 |
| Zürich, CH | 4 |
| Frauenfeld, CH | 4 |
| Tromso University Museumlocation not on record | 4 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 4 |
| Porvoo, FI | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| GMBAlocation not on record | 3 |
| Fulda, DE | 3 |
| Glarus, CH | 3 |
| Namur, BE | 3 |
| CICYTEXlocation not on record | 2 |
| Sion, CH | 2 |
| Göteborg, SE | 2 |
| Wellington, NZ | 2 |
| Shanghai, CN | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Taipei, TW | 2 |
| BSBIlocation not on record | 2 |
| Wuhan, CN | 2 |
| Salvador, BR | 2 |
| CJBNlocation not on record | 1 |
| Salamanca, ES | 1 |
| nlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Saint Louis, US | 1 |
| Tula State Universitylocation not on record | 1 |
| Tilburg, NL | 1 |
| GZUlocation not on record | 1 |
| Lausanne, CH | 1 |
| Monastir, TN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Shanghai, CN | 1 |
| Hobart, AU | 1 |
| Stockholm, SE | 1 |
| WTUlocation not on record | 1 |
| Boumlocation not on record | 1 |
| Xiamen, CN | 1 |
| Zürich, CH | 1 |
| Awka, NG | 1 |
| Yangling, CN | 1 |
| LfUlocation not on record | 1 |
| SZUlocation not on record | 1 |
108 institutions · 4 030 of 4 399 vouchered records shown · 313 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA8 detections
Where the DNA of Epilobium roseum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.3 °C 10.2–17.3
Seasonal swing summer↔winter14.1 °C
Max temp (day)17.6 °C 12.1–20.4
Min temp (night)10.9 °C 7.20–14.3
Precipitation104 mm/mo 79.6–133
Air humidity63.8 % 61.7–66.7
Moisture balance15.2 mm/mo
Vapour deficit586 Pa 458–745
Wind speed4.90 m/s
Cloud cover51.5 % 43.0–65.9
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.