Epilobium pycnostachyum

Hausskn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records539

Data sources6

Biological traits3

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Epilobium pycnostachyum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility539 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF539 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Epilobium pycnostachyum là một loài thực vật có hoa trong họ Anh thảo chiều. Loài này được Hausskn. mô tả khoa học đầu tiên năm 1879.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.06 mg

Life cycle & reproduction1

Life formperennial or subshrub

Habitat & environment1

Climatesubalpine or subarctic

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium pycnostachyum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences5

The DNA barcodea real sequence read deposited for this species

ITSEF416678.1 ↗612 bp

ACGT

GTCGATCCTGCATAGCAGAACAACCCGAGAACCGGTTAACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCTT …

Epilobium pycnostachyum voucher AK298170 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium pycnostachyum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · new-zealand · CCDB · book-ipcn75-78

CCDB · new-zealand

CCDB · book-ipcn75-78 — Hair 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type539 records

Wild obs. + sensor329

Museum / vouchered210

Range

Area of Occupancy AOO1 136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 158≤1 km 73≤10 km 23>10 km 7

261 georeferenced · 68 without coordinates

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 2

5 georeferenced · 205 without coordinates

Open the institutions mapphysical evidence210

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	111
Wellington, NZ	63
Auckland, NZ	28
Hobart, AU	3
Rotorua, NZ	3
Flagstaff, US	1
Chicago, US	1

7 institutions · 210 of 210 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)