Epilobium pedunculare

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records1 058

Data sources9

Biological traits12

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Epilobium pedunculare's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 058 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources12 traits

Occurrence & distributionGBIF1 058 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Epilobium pedunculare (E. linnaeoides), the rockery willowherb, is a species of Epilobium similar to E. brunnescens.Webb, D.A., Parnell, J. and Doogue, D. 1996. An Irish Flora. Dundalgan Press (W.Tempest) Ltd. Dundalk. It is found on the Antipodean Islands, Chatham Island, Macquarie Island, and both the North and South Island of New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology1

Seed mass0.026 mg

Life cycle & reproduction5

Dispersal typeanimal

Life formsubshrub

Life spanperennial

Reproduction asexualpresent

Sex typehermaphrodite

Habitat & environment6

Climatetemperate

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Mycorrhiza type0.0000127

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium pedunculare has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSEF416662.1 ↗610 bp

ACGT

GTCGAATCCTGCATGGCAGAACAACCCGAGAACCGGTTAACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCT …

Epilobium pedunculare voucher AK298147 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium pedunculare carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 365×CCDB · new-zealand · CCDB · book-ipcn75-78 · CCDB · book-fedorov +1

CCDB · new-zealand

CCDB · book-ipcn75-78 — Hair 1977

CCDB · book-fedorov — Moore D. M. 1960

CCDB · book-fedorov — Hair 1942

CCDB · book-atlas-flowering-plants — Hair 1942

n 181×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Hair 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 058 records

Wild obs. + sensor767

Museum / vouchered291

Origin

Native1

Introduced71

Range

Area of Occupancy AOO2 760 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 475≤1 km 84≤10 km 146>10 km 6

711 georeferenced · 56 without coordinates

Open the mapobservation + sensor767

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 7≤1 km 51≤10 km 12>10 km 4

74 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence291

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	91
Auckland, NZ	63
Christchurch, NZ	48
Hobart, AU	36
Rotorua, NZ	11
Canberra, AU	11
AADClocation not on record	7
Adelaide, AU	5
Museo Entomologico de Leonlocation not on record	3
QVMAGlocation not on record	3
LDlocation not on record	2
Moscow State Universitylocation not on record	1
Paris, FR	1
Uniwersytet Jagiellońskilocation not on record	1
MAlocation not on record	1
Mount Annan, AU	1
Brisbane, AU	1
Honolulu, US	1
South Kensington, GB	1
Armidale, AU	1

20 institutions · 289 of 291 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epilobium pedunculare

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction5

Habitat & environment6

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 058 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 20 geolocated

Record type1 058 records