Epilobium parviflorum
Schreb. · speciesAt a glance
Occurrence records257 561
Data sources14
Biological traits68
DNA specimens43
eDNA detections19
Sources14 archives
Databases and archives Epilobium parviflorum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility257 561 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources68 traits
Chemical compositionLOTUS · NPASS46 compounds
Occurrence & distributionGBIF257 561 records
Environmental DNA1 datasets · 4 countries19 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB · GoaT411 Mbp
01Narrative
Epilobium parviflorum, l'Épilobe à petites fleurs ou encore Épilobe-mollet, est une espèce de plantes à fleurs de la famille des onagracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology26
Fruit length50 mm
Fruit length max70 mm
Fruit length min30 mm
Leaf length max120 mm
Leaf length min20 mm
Leaf mass22.7 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 694 mm² · GIFT: 779 mm²
Leaf width23 mm
Leaf width max35 mm
Leaf width min5 mm
Plant height0.617 m
⚠ sources differ — GIFT: 0.617 m · LEDA: 0.45 m · TRY: 0.567 m
Plant height generative0.55 m
Plant height max1.4 m
Plant height min0.15 m
Seed length0.927 mm
⚠ sources differ — TRY: 0.927 mm · GIFT: 1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.096 mg
⚠ sources differ — TRY: 0.096 mg · LEDA: 0.075 mg · GIFT: 0.092 mg
Seed mass max0.13 mg
Seed mass min0.07 mg
Seed volume0.082 mm³
Seed volume max0.082 mm³
Seed volume min0.082 mm³
Seed width0.45 mm
Seed width max0.45 mm
Seed width min0.45 mm
Life cycle & reproduction16
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower colourpink
Flower length max8 mm
Flower length min6 mm
Flowering endSep
Flowering startJun
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation mean1 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTcanals, swamps
Leaf formelliptic
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)160 mg/g
Leaf n24.81 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)32.82 mm²/mg
⚠ sources differ — TRY: 32.82 mm²/mg · LEDA: 29.75 mm²/mg · GIFT: 29.78 mm²/mg
Other traits4
Diaspore typegerminule
Leaf arrangementopposite
Seeds per fruit>1000
Shoot orientationerect
03Chemical composition46 compounds
Compounds documented for Epilobium parviflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Secoiridoid monoterpenoids17
Unsaturated fatty acids7
Dihydroflavonols4
Flavonols4
Cinnamic acids and derivatives $ Phenylethanoids3
Documented compounds46 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,5S,6E,7S,14R,15S,16S,17R)-6-ethylidene-16-(hydroxymethyl)-14,17-dimethyl-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,8,12-trioxatricyclo[13.2.1.05,10]octadec-9-ene-3,11-dione | present | NPASS | |
| (2S,3R)-5,7-dihydroxy-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2S,3R)-5,7-dihydroxy-3-[(2S,3R,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2S,3R)-5,7-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (4S,5E,6S)-5-ethylidene-4-[2-[(1S,2R,3S,4S)-3-[[2-[(2S,3E,4S)-3-ethylidene-5-methoxycarbonyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-4-yl]acetyl]oxymethyl]-4-[(2S)-1-hydroxypropan-2-yl]-2-methylcyclopentyl]oxy-2-oxoethyl]-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4H-pyran-3-carboxylic acid | present | NPASS | |
| (5R,6S,8S,9R,10S,15S,16E,17S)-16-ethylidene-8-hydroxy-5,9-dimethyl-17-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,12,18-trioxatricyclo[13.4.0.06,10]nonadec-1(19)-ene-2,13-dione | present | NPASS | |
| [(10R,11S,12R,13R,15R)-3,4,5,13,21,22,23-heptahydroxy-8,18-dioxo-11-(3,4,5-trihydroxybenzoyl)oxy-9,14,17-trioxatetracyclo[17.4.0.02,7.010,15]tricosa-1(23),2,4,6,19,21-hexaen-12-yl] 2-[[(10S,11S,12R,13S,15R)-3,4,5,12,22,23-hexahydroxy-8,18-dioxo-11,13-bis[(3,4,5-trihydroxybenzoyl)oxy]-9,14,17-trioxatetracyclo[17.4.0.02,7.010,15]tricosa-1(23),2,4,6,19,21-hexaen-21-yl]oxy]-3,4,5-trihydroxybenzoate | present | LOTUS | |
| [(2R,3R,4R,5R,6R)-2-[[(2R,3R,4S)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxymethyl]-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | NPASS | |
| [(2R,3R,4R,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-5-hydroxy-4-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-[[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate | present | NPASS | |
| [(2R,3R,4S,5R,6S)-6-[[(2S,3R)-5,7-dihydroxy-4-oxo-2-(3,4,5-trihydroxyphenyl)-2,3-dihydrochromen-3-yl]oxy]-3,4,5-trihydroxyoxan-2-yl]methyl 3,4,5-trihydroxybenzoate | present | LOTUS |
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium parviflorum has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes10
GenBank sequences10
eDNA detections19
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCAATCATC …
Epilobium parviflorum voucher JAG 0649WP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL8★rbcLa★trnL-F★ITS2★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Epilobium parviflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size410 760 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Epilobium parviflorum0.41 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidydiploid inferred
Chromosome records18–362n range36median36mode39records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3638×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · brit-fl — Raven, P.H., Moore, D.M. Watsonia 6: 36-38 (1964)
CCDB · brit-fl — Thakur, V. (1965)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XII. Onagraceae Queirs, M.Bol. Soc. Brot. ser. 250: 107-116(1976).
CCDB · iber-fl — Cytotaxonomy of spanish plants. IV.-Dicotyledons: Caesalpinacea-Asteracea. Lve, A. & E. Kjellqvist.Lagascalia4(2): 153-211(1974).
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3047
CCDB · poland — Izmai?ow R. 1977. Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20, 101-111.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn75-78 — Izmailow 1977
CCDB · book-ipcn75-78 — Queiros 1976
CCDB · book-ipcn75-78 — Murin 1974
CCDB · book-ipcn75-78 — Hair 1977
CCDB · book-ipcn75-78 — Loon & Jong 1978
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-indian_vol1 — Schwemmle, J. 1924; Tischler, G. 1934; Rohweder, H. 1937; Straub, J. 1941; Gagnieu, A. & Linder, R. 1954, 1955; Raven, P.H. & Moore, D.M. 1964; Van Loon, J. Chr. & de Jong, H.1978
CCDB · eflora
CCDB · book-fedorov — Schwemmle 1924
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Rohweder 1937
CCDB · book-fedorov — Straub 1941
CCDB · book-fedorov — Gagnieu, Linder 1954, 1955 (L. 1961 l
CCDB · book-fedorov — Raven, Moore 1964
CCDB · CromoCat 2015 — Izmailow R. (1977). Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20(1-2): 101-111.
CCDB · CromoCat 2015 — Loon van, J. C. & de Jong, H. (1978). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIX]. Taxon 27(1): 56-61.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1974b). Cytotaxonomy of Spanish plants. IV.-Dicotyledons: Caesalpinaceae-Asteraceae. Lagascalia 4(2): 153-211.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Queirós, M. (1976). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XII. Onagraceae. Bol. Soc. Brot. 50: 107-116.
CCDB · CromoCat 2015 — Gagnieu, A. & Linder, R. (1954). Material pour expérimentation et démonstration. Jard. Bot. Strasbourg. Index Seminum 1954: 13-16.
CCDB · CromoCat 2015 — Gagnieu, A. & Linder, R. (1955). Material pour expérimentation et démonstration. Jard. Bot. Strasbourg. Index Seminum 1955: 19-22.
CCDB · CromoCat 2015 — Hair, J. B. (1977). Contributions to a chromosome atlas of the New Zealand Flora. 18. Epilobium (Onagraceae). New Zealand J. Bot. 15: 5-15.
CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.
CCDB · CromoCat 2015 — Schwemmle, J. (1924). Vergleichend zytologische untersuchungen an Onagraceen. Ber. Deutsch. Bot. Ges. 42: 238-243.
CCDB · CromoCat 2015 — Straub, J. (1941). Die cytologie der haploiden Epilobien und die phylogenie der gattung. Biol. Zentralbl. 61: 573-588.
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
n 184×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977a). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107-119.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type257 561 records
Wild obs. + sensor248 384
Museum / vouchered8 604
Cultivated / captive40
Other533
Origin
Native19 101
Introduced1
Range
Area of Occupancy AOO307 544 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy38% within 1 km
≤100 m 36 716≤1 km 41 371≤10 km 127 933>10 km 986
207 006 georeferenced · 41 378 without coordinates
Open the mapobservation + sensor248 384
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 1 642≤1 km 1 122≤10 km 1 848>10 km 252
4 864 georeferenced · 3 740 without coordinates
Open the institutions mapphysical evidence8 604
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 12
12 georeferenced · 28 without coordinates
Open the mapnot free-living40
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions114 of 215 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| DBF-NHMDlocation not on record | 1 213 |
| Uniwersytet Wrocławskilocation not on record | 969 |
| LDlocation not on record | 601 |
| BRNUlocation not on record | 289 |
| MeiseBGlocation not on record | 284 |
| BIO-UNIPIlocation not on record | 270 |
| BFLlocation not on record | 241 |
| Helsinki, FI | 228 |
| Moscow State Universitylocation not on record | 210 |
| SLU Artdatabankenlocation not on record | 209 |
| Salzburg, AT | 158 |
| València, ES | 139 |
| Adam Mickiewicz University in Poznańlocation not on record | 135 |
| IFR-DNFlocation not on record | 114 |
| Berlin, DE | 110 |
| Oskarshamn, SE | 108 |
| Provincia di Livornolocation not on record | 103 |
| Beijing, CN | 102 |
| Tartu, EE | 100 |
| MAlocation not on record | 97 |
| South Kensington, GB | 74 |
| Entomological Society of Latvialocation not on record | 72 |
| Barcelona, ES | 71 |
| BDBClocation not on record | 68 |
| Yangling, CN | 68 |
| Görlitz, DE | 59 |
| WNNUlocation not on record | 57 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 56 |
| Turku, FI | 55 |
| Bern, CH | 53 |
| Vitoria, ES | 52 |
| Uppsala, SE | 48 |
| BClocation not on record | 47 |
| Chongqing Museumlocation not on record | 43 |
| Olocation not on record | 40 |
| Tallinn, EE | 39 |
| TUR-Alocation not on record | 38 |
| PRClocation not on record | 36 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 35 |
| Christchurch, NZ | 35 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 34 |
| GJOlocation not on record | 32 |
| CJBGlocation not on record | 31 |
| Podgorica, ME | 29 |
| Uniwersytet Warszawskilocation not on record | 28 |
| Mlocation not on record | 26 |
| Uniwersytet Jagiellońskilocation not on record | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Kunming, CN | 20 |
| Salamanca, ES | 19 |
| Ann Arbor, US | 19 |
| Chengdu, CN | 19 |
| Granada, ES | 19 |
| Zürich, CH | 18 |
| Frankfurt am Main | 18 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 17 |
| Urumqi, CN | 16 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Wlocation not on record | 15 |
| ISAlocation not on record | 14 |
| UGentlocation not on record | 14 |
| Madrid, ES | 14 |
| Pamplona, ES | 13 |
| Oulu, FI | 13 |
| Porrentruy, CH | 11 |
| Phyletisches Museum Jenalocation not on record | 11 |
| Alicante, ES | 11 |
| CICYTEXlocation not on record | 10 |
| Bando, JP | 10 |
| BSBIlocation not on record | 10 |
| Urumqi, CN | 10 |
| McWane Science Centerlocation not on record | 9 |
| Vancouver, CA | 9 |
| Voronezh State Universitylocation not on record | 9 |
| Xinxiang, CN | 9 |
| Zhengzhou, CN | 8 |
| Zürich, CH | 8 |
| Toronto, CA | 8 |
| GMBAlocation not on record | 8 |
| Frauenfeld, CH | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| Winterthur, CH | 7 |
| Wuhan, CN | 7 |
| Philadelphia, US | 7 |
| Tilburg, NL | 7 |
| Glarus, CH | 7 |
| Xining, CN | 6 |
| John May Museum of Natural Historylocation not on record | 6 |
| PrivatHerblocation not on record | 6 |
| Wellington, NZ | 6 |
| Nanjing, CN | 6 |
| Museo Achille Folettolocation not on record | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| Badajoz, ES | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Madison, US | 5 |
| Royal Botanical Gardenslocation not on record | 5 |
| Sevilla, ES | 5 |
| Fukushima Universitylocation not on record | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Oregon State Universitylocation not on record | 5 |
| Córdoba, ES | 5 |
| Lanzhou, CN | 5 |
| Bourges, FR | 5 |
| Guangzhou, CN | 5 |
| Karlsruhe, DE | 4 |
| Sendai, JP | 4 |
| Dresden, DE | 4 |
| Xian, CN | 4 |
| Pamplona, ES | 4 |
| GZUlocation not on record | 4 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 4 |
| Auckland, NZ | 4 |
| Trondheim, NO | 4 |
| EEZA-CSIClocation not on record | 3 |
| Porvoo, FI | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Lausanne, CH | 3 |
| Changsha, CN | 3 |
| Jyväskylä, FI | 3 |
| Sion, CH | 3 |
| ZRC-SAZUlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| SZUlocation not on record | 3 |
| Rotorua, NZ | 3 |
| Nanchong, CN | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| BGBMlocation not on record | 2 |
| JBSlocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Xiamen, CN | 2 |
| Dehra Dun, IN | 2 |
| National Museum Waleslocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| Whitehorse, CA | 2 |
| WTUlocation not on record | 2 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 2 |
| Hobart, AU | 2 |
| Bergen, NO | 2 |
| Kuopio, FI | 2 |
| TROMlocation not on record | 2 |
| Elikins, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| Saint Louis, US | 2 |
| Peking Universitylocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| LfUlocation not on record | 2 |
| Toyama, JP | 2 |
| Salvador, BR | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Millersville, US | 2 |
| Jaén, ES | 2 |
| Taipei, TW | 2 |
| KMNlocation not on record | 2 |
| University of Birminghamlocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Saint John, CA | 1 |
| Odawara, JP | 1 |
| Oswego, US | 1 |
| Guiyang, CN | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Brussel, BE | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| München, DE | 1 |
| H-Dunkellocation not on record | 1 |
| Davenport, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Nagano City, JP | 1 |
| Seoul, KR | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Monastir, TN | 1 |
| Nijmegen, NL | 1 |
| Pullman, US | 1 |
| Guilin, CN | 1 |
| Namur, BE | 1 |
| Acadia Universitylocation not on record | 1 |
| Kew, GB | 1 |
| ESP003location not on record | 1 |
| Morgantown, US | 1 |
| H-AkrKGlocation not on record | 1 |
| Chicago, US | 1 |
| Philadelphia, US | 1 |
| Sant Julià de Lòria, AD | 1 |
| Banyoles, ES | 1 |
| Denver, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Logan, US | 1 |
| Wuzhou, CN | 1 |
| HUFDlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Chengdu, CN | 1 |
| Göteborg, SE | 1 |
| Dekalb, US | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Turlock, US | 1 |
| Fulda, DE | 1 |
| Boumlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Philadelphia, US | 1 |
| Stockholm, SE | 1 |
215 institutions · 7 720 of 8 604 vouchered records shown · 807 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Epilobium parviflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map4 countries0
in ditch
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 15.2–21.4
Seasonal swing summer↔winter20.7 °C
Max temp (day)20.5 °C 17.5–25.9
Min temp (night)14.7 °C 10.4–18.6
Precipitation81.2 mm/mo 67.2–101
Air humidity60.0 % 57.6–63.4
Moisture balance-47.9 mm/mo -78.4–29.7
Vapour deficit804 Pa 659–1,075
Wind speed3.30 m/s 2.70–6.00
Cloud cover40.4 % 38.1–50.7
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.