Epilobium palustre

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records254 082

Data sources15

Biological traits64

DNA specimens70

eDNA detections34

Sources15 archives

Databases and archives Epilobium palustre's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility254 082 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI34 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics70 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources64 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF254 082 records

Environmental DNA1 datasets · 6 countries34 detections

DNA & barcodingBOLD · NCBI70 specimens

Genome at a glanceCCDB · GoaT381 Mbp

01Narrative

Epilobium palustre, l'épilobe des marais, est une espèce de plantes à fleurs du genre Epilobium de la famille des Onagraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology20

Fruit length60 mm

Fruit length max90 mm

Fruit length min30 mm

Leaf length max35 mm

Leaf length min10 mm

Leaf mass5.5 mg

Leaf size316 mm²

⚠ sources differ — TRY: 316 mm² · LEDA: 189 mm² · GIFT: 492 mm²

Leaf width max10 mm

Leaf width min3 mm

Plant height0.275 m

⚠ sources differ — GIFT: 0.275 m · LEDA: 0.3 m · TRY: 0.385 m

Plant height generative0.35 m

Plant height max0.8 m

Plant height min0.03 m

Seed length1.59 mm

Seed mass0.047 mg

⚠ sources differ — TRY: 0.047 mg · LEDA: 0.09 mg · GIFT: 4.04 mg

Seed mass max0.05 mg

Seed mass min0.04 mg

Seed volume0.093 mm³

Seed volume max0.1 mm³

Seed volume min0.087 mm³

Life cycle & reproduction17

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: evergreen

Dehiscencedehiscent

Dispersal typewater

⚠ sources differ — LEDA: nautochor · GIFT: anemochorous

Flower colourpink

Flower length max9.5 mm

Flower length min6 mm

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Seed number13 524

Self fertilizationpresent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment14

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 500 m

Elevation mean2 525 m

Elevation min200 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTarctic, forest, lakes, rivers, shores, steppe, swamps

Leaf formlinear

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry8

Leaf C:N ratio28.01 g/g

Leaf c419 mg/g

Leaf dry-matter content (LDMC)153 mg/g

Leaf n15.26 mg/g

Leaf p3.54 mg/g

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)43.66 mm²/mg

⚠ sources differ — TRY: 43.66 mm²/mg · LEDA: 34.4 mm²/mg · GIFT: 33.61 mm²/mg

Other traits3

Diaspore typeone-seeded generative dispersule

Leaf arrangementopposite

Shoot orientationprostrate

03Chemical composition3 compounds

Compounds documented for Epilobium palustre across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols3

Documented compounds3 total

Compound	Amount	Source
Myricetin 3-glucoside	present	LOTUS
Myricitrin	present	LOTUS
Quercitrin	present	LOTUS

05DNA & barcoding70 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium palustre has left across the world's sequence archives.

At a glance

DNA specimens70

Marker genes7

GenBank sequences10

eDNA detections34

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMT923914.1 ↗668 bpChina

ACGT

CCTGCGGAAGGATCATTGTCGAATCCTGCACAGCAGAACAACCTGAGAACCGGTTAATAACCAACTGGGATAATGGGGGGCATATGCCCC …

Epilobium palustre isolate Ge130329 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK3rbcL6rbcLatrnL-FITS1ITS1ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Epilobium palustre carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size381 420 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Epilobium palustre0.38 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidy2× diploid · measured

Chromosome records18–362n range36median36mode56records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3653×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +15

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Uhríková A., 1987: Karyological study of the Slovak flora XXII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 34: 33-37.

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · iapt — IAPT/IOPB Chromosome Data 9

CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)

CCDB · brit-fl — Raven, P.H., Moore, D.M. Watsonia 6: 36-38 (1964)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3054

CCDB · fl-europaea — Raven !& Moore,

CCDB · poland — Izmai?ow R. 1977. Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20, 101-111.

CCDB · ipcn-api-dl — Kirschner, J., J. Stepanek & J. Stepankova. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 574–575.

CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.

CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chromosome numbers in some species of vascular plants from Byelorussia. Bot. Zhurn. SSSR 71: 1145–1147.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk

CCDB · ipcn-api-dl — Semerenko, L. V. 1990. Chromosome numbers of some flowering plants from the Berezinsky Biosphere Reservation (the Byelorussian Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 279–282.

CCDB · ipcn-api-dl — Krasnikov, A. A. & D. N. Schaulo. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. II. Bot. Žhurn. (Moscow & Leningrad) 75: 118–120.

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.

CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977a. Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195–200.

CCDB · ipcn-api-dl — Uhríková, A. 1987. Karyological study of the Slovak flora XXII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 34: 33–37.

CCDB · book-ipcn66 — Love & Ritchie 1966; Love & LOve 1966b

CCDB · book-ipcn75-78 — Izmailow 1977

CCDB · book-ipcn75-78 — Zhukova & Petrovsky 1976

CCDB · book-ipcn75-78 — Zhukova et al. 1977a

CCDB · book-ipcn75-78 — Murin 1978

CCDB · book-indian_vol1 — Mosquin, T.1968; Scholte, G. 1977

CCDB · book-indian_vol1 — Bocher, T.W. 1938a; Rutland, J.P. 1941; Love, A. & Love, D. 1948, 1956b, 1966; Gagnieu, A. & Linder, R. 1954, 1955; Raven, P.H. & Moore, D.M. 1964; Love, A. & Ritchie, J.C. 1966; Johnson, A.W. & Packer, J. G. 1968 ; Podlech, D. & Dieterle, A. 1969

CCDB · eflora

CCDB · book-fedorov — Bacher 1938a

CCDB · book-fedorov — Rutland 1941

CCDB · book-fedorov — LOve A., LOve D. 1948, 1956b, 1966

CCDB · book-fedorov — Gagnieu, Linder 1954, 1955 (L. 1961)

CCDB · book-fedorov — Raven, Moore 1964 .

CCDB · book-fedorov — Love A., Ritchie L.966

CCDB · book-atlas-flowering-plants — 1948

CCDB · kew — Band SR. (pers. comm. 1984).

CCDB · Cave1956 — Love & Love b

CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A. & Rosbakh, S. A. (2010). IAPT/IOPB Chromosome Data 9 Taxon 59 (4): 1298-1299

CCDB · CromoCat 2015 — Dmitrieva, S. A. (1986a). Chromosome numbers in some species of vascular plants from Byelorussia. Bot. Žurn. 71: 1145-1147.

+12 more references

2n 183×CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · ipcn-api-dl — Gvinianidze, Z. I. & A. A. Avazneli. 1982. Khromosomnye chisla nekotorykh predstavitelej vysokogornykh floristicheskikh kompleksov Kavkaza. Soobkskc. Akad. Nauk Gruzinskoi SSR, Inst. Bot., Trudy, Ser. Geobot. 106 (3): 577–580.

CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.

CCDB · CromoCat 2015 — Stepanov, N. V. (1994a). Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žurn. 79(2): 135-139.

2n 02×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789

CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790

n 186×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.

CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977a. Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195–200.

CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid

CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977a). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107-119.

CCDB · CromoCat 2015 — Kumar, S, Kumari, S & Gupta, R. C (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1789-1790

n 93×CCDB · iapt · CCDB · CromoCat 2015

CCDB · iapt — IAPT/IOPB Chromosome Data 12

CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type254 082 records

Wild obs. + sensor235 954

Museum / vouchered17 442

Cultivated / captive34

Other652

Origin

Native23 405

Introduced3

Range

Area of Occupancy AOO365 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 74 196≤1 km 54 556≤10 km 79 795>10 km 1 323

209 870 georeferenced · 26 084 without coordinates

Open the mapobservation + sensor235 954

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 2 231≤1 km 3 414≤10 km 4 501>10 km 1 744

11 890 georeferenced · 5 552 without coordinates

Open the institutions mapphysical evidence17 442

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 13

14 georeferenced · 20 without coordinates

Open the mapnot free-living34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions147 of 283 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	3 867
Helsinki, FI	1 251
DBF-NHMDlocation not on record	1 174
Moscow State Universitylocation not on record	923
LDlocation not on record	722
Olocation not on record	659
Oulu, FI	450
Trondheim, NO	359
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	288
TROMlocation not on record	274
BRNUlocation not on record	271
Québec, CA	261
SLU Artdatabankenlocation not on record	253
Salzburg, AT	198
Université Lavallocation not on record	198
Bergen, NO	196
Garðabær, IS	182
Oskarshamn, SE	180
Turku, FI	178
Beijing, CN	175
MeiseBGlocation not on record	170
Tartu, EE	169
Adam Mickiewicz University in Poznańlocation not on record	156
Madison, US	126
Görlitz, DE	107
KMNlocation not on record	98
Jyväskylä, FI	95
Kuopio, FI	91
Uppsala, SE	89
Montréal, CA	89
TUR-Alocation not on record	89
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	87
Brussel, BE	86
South Kensington, GB	86
BFLlocation not on record	81
Chicago, US	73
Institute of Applied Ecology, Academia Sinicalocation not on record	67
	65
Bern, CH	62
Tallinn, EE	58
Philadelphia, US	56
Barcelona, ES	53
Acadia Universitylocation not on record	53
University of Alberta Museumslocation not on record	52
Provincia di Livornolocation not on record	50
WNNUlocation not on record	47
Entomological Society of Latvialocation not on record	46
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	42
Chongqing Museumlocation not on record	42
WTUlocation not on record	41
Kandalaksha State Nature Reservelocation not on record	40
BIO-UNIPIlocation not on record	39
Xining, CN	39
Yangling, CN	38
St. Paul, US	38
BDBClocation not on record	38
Vancouver, CA	35
GJOlocation not on record	35
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	33
University of Stellenboschlocation not on record	32
Tsukuba, JP	31
MAlocation not on record	29
Ann Arbor, US	29
Conservatoire botanique national du Bassin parisienlocation not on record	29
Institute of the biological problems of the North FEB RASlocation not on record	26
Saint John, CA	26
Rovaniemi, FI	24
Porvoo, FI	24
Philadelphia, US	23
València, ES	22
BClocation not on record	22
University of New Hampshirelocation not on record	22
Moscow, US	21
CJBGlocation not on record	21
Podgorica, ME	21
NSMKlocation not on record	20
Uniwersytet Warszawskilocation not on record	19
Yukon Universitylocation not on record	19
Mlocation not on record	18
Wuhan, CN	18
Frankfurt am Main	18
Kunming, CN	18
Uniwersytet Jagiellońskilocation not on record	17
Wlocation not on record	17
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	17
Urumqi, CN	17
Herbarium of the Department of Botany, University of Tokyolocation not on record	17
WINlocation not on record	16
Anchorage, US	16
Chengdu, CN	16
No collectionlocation not on record	16
Servico de Microbiologia e Imunologialocation not on record	16
Burlington, US	16
Chengdu, CN	15
Whitehorse, CA	15
nbflocation not on record	14
Voronezh State Universitylocation not on record	14
IWEP FEB RASlocation not on record	14
Paris, FR	14
Nanjing, CN	13
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	13
Karlsruhe, DE	13
Bronx, US	12
Bloomington, US	11
Pullman, US	11
New Haven, US	11
Philadelphia, US	11
Toronto, CA	10
Natural History Museum Rotterdamlocation not on record	10
Porrentruy, CH	9
Kyoto Universitylocation not on record	9
McWane Science Centerlocation not on record	9
Berlin, DE	9
Inner Mongolia Universitylocation not on record	9
NMBU:MINAlocation not on record	8
Victoria, CA	8
University of Wisconsinlocation not on record	8
Lanzhou, CN	8
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	7
BSBIlocation not on record	7
Boise, US	7
Salamanca, ES	7
University of Manitoba Herbariumlocation not on record	7
Pocatello, US	6
ENTClocation not on record	6
Kew, GB	6
UGentlocation not on record	6
Spearfish, US	6
CICYTEXlocation not on record	6
The State Museum-Preserve "The Kulikovo pole"location not on record	6
Madrid, ES	6
PRClocation not on record	6
Uniwersytet Śląski w Katowicachlocation not on record	6
Provo, US	6
Forssa, FI	5
Vitoria, ES	5
Frauenfeld, CH	5
Green Bay, US	5
Shanxi Institute of Biologylocation not on record	5
Stockholm, SE	5
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	5
Sichuan Grassland Research Institutelocation not on record	5
Tula State Universitylocation not on record	5
Dresden, DE	5
DOI/FWS, Kenai National Wildlife Refugelocation not on record	5
Edinburgh, GB	5
Durham, US	4
Cambridge, US	4
Zürich, CH	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	4
Caldwell, US	4
Uniwersytet Opolskilocation not on record	4
Bozeman, US	4
Bangkok, TH	4
Guilin, CN	4
Royal Botanic Garden Edinburghlocation not on record	4
Kushiro City Museumlocation not on record	4
Tianjin Natural History Museumlocation not on record	4
Tromso University Museumlocation not on record	4
Guangzhou, CN	4
Granada, ES	4
National Museum Waleslocation not on record	4
Tomioka, JP	4
College of the Atlantic, Museumlocation not on record	4
National Institute of Biological Resourceslocation not on record	4
San Jose State University, Museum of Birds and Mammalslocation not on record	4
GMBAlocation not on record	4
Lausanne, CH	4
Beijing, CN	4
Museo Achille Folettolocation not on record	4
John May Museum of Natural Historylocation not on record	4
Pittsburg, US	3
Xiamen, CN	3
Wellington, NZ	3
PrivatHerblocation not on record	3
Davis, US	3
Fargo, US	3
Canadian Museum of Naturelocation not on record	3
Naturalis Biodiversity Centerlocation not on record	3
Research Collection of B. A. Bennettlocation not on record	3
Tempe, US	3
Tilburg, NL	3
SZUlocation not on record	3
Wuzhou, CN	3
Centre for Biodiversity Genomicslocation not on record	3
Hebei Normal Universitylocation not on record	3
Nanjing, CN	3
Sion, CH	3
Ypsilanti, US	3
LfUlocation not on record	3
GB	3
Saint Louis, US	3
GZUlocation not on record	3
Toyama, JP	2
Beijing Natural History Museumlocation not on record	2
Oswego, US	2
KR	2
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	2
Brisbane, AU	2
Montréal, CA	2
University of Lethbridgelocation not on record	2
Glarus, CH	2
University of Hulllocation not on record	2
Columbia, US	2
Herb. BBGlocation not on record	2
Dhaka, BD	2
Dekalb, US	2
Bando, JP	2
Davenport, US	2
Zhengzhou, CN	2
Bourges, FR	2
H-Schuhwlocation not on record	2
Jiangxi College of Educationlocation not on record	2
Phoenix, US	2
Arcata, US	2
Ivano-Frankove, UA	2
东北师范大学自然博物馆location not on record	2
Hobart, AU	1
Chadron, US	1
Universidad de La Salle (La Salle)location not on record	1
Fukushima Universitylocation not on record	1
Metsähallituslocation not on record	1
FLADlocation not on record	1
Mount Pleasant, US	1
IPE-CSIClocation not on record	1
Urumqi, CN	1
Capital Normal Universitylocation not on record	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Turlock, US	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Northeastern Forestry Universitylocation not on record	1
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	1
Trois-Rivières, CA	1
UoB-IBlocation not on record	1
Logan, US	1
JMSlocation not on record	1
Musée des Confluenceslocation not on record	1
Oregon State Universitylocation not on record	1
AUAlocation not on record	1
Claremont, US	1
Gijón, ES	1
Chengdu, CN	1
Guiyang, CN	1
Waverly, US	1
Central China Normal Universitylocation not on record	1
Tuscaloosa, US	1
Tulane Universitylocation not on record	1
Keene State Universitylocation not on record	1
Hudson, US	1
Fribourg, CH	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Chicago, US	1
Salvador, BR	1
Alicante, ES	1
Miami, US	1
Yellowstone National Park Herbariumlocation not on record	1
Umeå Universitylocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Sant Julià de Lòria, AD	1
Namur, BE	1
ROM007location not on record	1
Museo Entomologico de Leonlocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Nagano City, JP	1
Churchill Northern Studies Centrelocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
B.A. Bennett Herbariumlocation not on record	1
Portland, US	1
Mississippi State, US	1
Chicago, US	1
Fulda, DE	1
CJBNlocation not on record	1
Millersville, US	1
Göteborg, SE	1
KIRMlocation not on record	1
Staten Island, US	1
BioFokuslocation not on record	1
ASUlocation not on record	1
Ashland, US	1
Emporia, US	1
Denver, US	1

283 institutions · 16 255 of 17 442 vouchered records shown · 1 054 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA34 detections

Where the DNA of Epilobium palustre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found34

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 34 detections have coordinates

Open the map6 countries0

Base of esker at lakeshore with Potentilla p…Base of dry slope near wet ditch/ponds. Care…in moist tall grasslandswamps

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 9.00–16.7

Seasonal swing summer↔winter26.3 °C

Max temp (day)15.1 °C 11.7–20.9

Min temp (night)8.60 °C 5.60–13.1

Precipitation88.7 mm/mo 55.5–111

Air humidity62.2 % 53.3–68.5

Moisture balance1.20 mm/mo

Vapour deficit510 Pa 395–771

Wind speed3.80 m/s

Cloud cover49.1 % 36.2–65.3

CHELSA 1981–2010, ~9 km grid, at location & month of 34 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources15 archives

Size & morphology20

Life cycle & reproduction17

Diet & foraging2

Habitat & environment14

Physiology & chemistry8

Other traits3

Compound class profile1 class

Documented compounds3 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type254 082 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions147 of 283 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type254 082 records