Epilobium minutum

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records1 243

Data sources8

Biological traits14

DNA specimens6

eDNA detections3

Sources8 archives

Databases and archives Epilobium minutum's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF1 243 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 26

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.073 mg

⚠ sources differ — TRY: 0.073 mg · GIFT: 0.067 mg

Seed mass max0.067 mg

Seed mass min0.067 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium minutum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences3

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSL28025.1 ↗613 bp

ACGT

GTCGAATCCTGCATAGCAGAACAACCCGAGAACCGGTTAACAACCAGTTTGGAGAACGGGGGCACCGCCCCGCTCTCAAACCCCGCTTCT …

Epilobium minutum internal transcribed spacer 1 and 2; 5.8S ribosomal RNA (5.8S rDNA) gene

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium minutum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×CCDB · book-fedorov

CCDB · book-fedorov — Kurabayashi et al. 1962

n 133×CCDB · ipcn-api-dl · CCDB · Cave1962

CCDB · ipcn-api-dl — Seavey, S. R., P. Wright & P. H. RAVEN. 1977. A comparison of Epilobium minutum and E. foliosum (Onagraceae). Madroño 24: 6–12.

CCDB · Cave1962 — Kurabayashi et al. 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 243 records

Wild obs. + sensor520

Museum / vouchered723

Range

Area of Occupancy AOO3 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 299≤1 km 42≤10 km 10>10 km 22

373 georeferenced · 147 without coordinates

Open the mapobservation + sensor520

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 67≤1 km 201≤10 km 117>10 km 15

400 georeferenced · 323 without coordinates

Open the institutions mapphysical evidence723

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	198
WTUlocation not on record	188
Corvallis, US	131
Moscow, US	63
Davis, US	38
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	30
Vancouver, CA	28
Madison, US	16
Bend, US	7
Wuzhou, CN	6
Severin-McDaniel Insect Collectionlocation not on record	2
Ann Arbor, US	2
Saint Louis, US	1
Santa Cruz, US	1
DOI/NPS, Mount Rainier National Parklocation not on record	1
Nanjing, CN	1
DOI/NPS, San Juan Island National Historical Parklocation not on record	1
Karlsruhe, DE	1
Oskarshamn, SE	1
EL PASO, US	1
Whitehorse, CA	1
Emporia, US	1
University of British Columbialocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Moscow State Universitylocation not on record	1

25 institutions · 722 of 723 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Epilobium minutum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

Gabbro meadow, Gabbro cliffs; gravel depress…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 12.2–19.5

Seasonal swing summer↔winter16.4 °C

Max temp (day)23.2 °C 19.2–27.2

Min temp (night)9.60 °C 6.30–12.8

Precipitation23.4 mm/mo 7.70–39.0

Air humidity54.9 % 53.9–56.0

Moisture balance-121 mm/mo -147–-94.3

Vapour deficit856 Pa 643–1,070

Wind speed2.40 m/s 1.80–3.00

Cloud cover25.8 % 18.1–33.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epilobium minutum

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 243 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 243 records