Epilobium komarovianum

H.Lév. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records448

Data sources6

Biological traits30

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Epilobium komarovianum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility448 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF448 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Epilobium komarovianum là một loài thực vật có hoa trong họ Anh thảo chiều. Loài này được H.Lév. mô tả khoa học đầu tiên năm 1908.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology7

Fruit length30 mm

Leaf width4 mm

Leaf width max4 mm

Leaf width min4 mm

Plant height0.08 m

Plant height max0.08 m

Plant height min0.01 m

Life cycle & reproduction11

Dehiscencedehiscent

Dispersal typewind

Flowering endJul

Flowering startJun

Life formsubshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Self fertilizationpresent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Habitat GIFTCoastal

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)258 mg/g

Photosynthetic pathwayC3

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium komarovianum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSEF416625.1 ↗610 bp

ACGT

GTCGAATCCTGCATAGCAGAACAACCCGAGAACCGGTTAACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCT …

Epilobium komarovianum voucher AK298276 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium komarovianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · new-zealand · CCDB · nw-europe-fl · CCDB · book-ipcn75-78

CCDB · new-zealand

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3059

CCDB · book-ipcn75-78 — Hair 1977

n 181×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Hair 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type448 records

Wild obs. + sensor308

Museum / vouchered140

Origin

Introduced28

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 144≤1 km 44≤10 km 57>10 km 9

254 georeferenced · 54 without coordinates

Open the mapobservation + sensor308

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 4≤1 km 10≤10 km 7>10 km 8

29 georeferenced · 111 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	52
Auckland, NZ	32
Christchurch, NZ	16
Helsinki, FI	7
Turku, FI	6
Rotorua, NZ	6
TUR-Alocation not on record	5
LDlocation not on record	5
Olocation not on record	2
Vancouver, CA	1
Moscow State Universitylocation not on record	1
Hobart, AU	1
BRNUlocation not on record	1
Trondheim, NO	1
Canberra, AU	1

15 institutions · 137 of 140 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)