Epilobium hirtigerum

A.Cunn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records4 181

Data sources7

Biological traits46

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Epilobium hirtigerum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 181 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources46 traits

Occurrence & distributionGBIF4 181 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

01Narrative

Epilobium hirtigerum, commonly known as the hairy willow herb, is a species in the family Onagraceae that is endemic to south western Australia. The species is found in the South West, Wheatbelt and Peel regions of Western Australia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology18

Fruit length47.5 mm

⚠ sources differ — AusTraits: 47.5 mm · GIFT: 60 mm

Leaf length37.5 mm

Leaf length max60 mm

Leaf length min15 mm

Leaf mass5.3 mg

Leaf mass per area45.62 g/m2

Leaf size246 mm²

Leaf width5 mm

Leaf width max8 mm

Leaf width min2 mm

Plant height0.7 m

⚠ sources differ — GIFT: 0.7 m · AusTraits: 1.1 m · TRY: 1.2 m

Plant height max1.5 m

Plant height min0.2 m

Seed length1 mm

Seed mass0.072 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Seed width0.1 mm

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typewind

Flowering timeyynnnnnnyyyy

Life formperennial, subshrub or shrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Resprouting capacityfire_killed

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTÁrea Antrópica, Floresta Ombrófila (= Floresta Pluvial), Vegetação Aquática, Vegetação Sobre Afloramentos Rochosos

Leaf compoundnesssimple

Leaf shapelinear narrowly_lanceolate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium hirtigerum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEF416619.1 ↗610 bp

ACGT

GTCGAATCCTGCATAGCAGAACAACCCGAGAACCGGTTAACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCT …

Epilobium hirtigerum voucher AK295310 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium hirtigerum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · new-zealand · CCDB · book-ipcn75-78

CCDB · new-zealand

CCDB · book-ipcn75-78 — Hair 1977

n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Solomon, J. C. 1982. The systematics and evolution of Epilobium (Onagraceae) in South America. Ann. Missouri Bot. Gard. 69(2): 239–335.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 181 records

Wild obs. + sensor3 370

Museum / vouchered810

Cultivated / captive1

Origin

Native399

Introduced2

Range

Area of Occupancy AOO11 492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 1 991≤1 km 1 007≤10 km 235>10 km 9

3 242 georeferenced · 128 without coordinates

Open the mapobservation + sensor3 370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 56≤1 km 148≤10 km 424>10 km 43

671 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence810

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	214
Adelaide, AU	119
Mount Annan, AU	101
Canberra, AU	99
Hobart, AU	55
Brisbane, AU	43
Kensington, AU	42
Christchurch, NZ	31
Armidale, AU	25
Wellington, NZ	10
Saint Louis, US	9
San Jose State University, Museum of Birds and Mammalslocation not on record	7
QVMAGlocation not on record	6
San Isidro, AR	4
Blumenau, BR	4
BGPAlocation not on record	3
Corrientes, AR	3
Kew, GB	3
Córdoba, AR	2
Rotorua, NZ	2
Wollongong, AU	2
Bronx, US	2
UNESClocation not on record	1
Criciúma, BR	1
Stockholm, SE	1
MAlocation not on record	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Ciudad Autónoma de Buenos Aires, AR	1
GB	1
AUAlocation not on record	1
Batemans Bay, AU	1
La Trobe Universitylocation not on record	1
EL PASO, US	1
Palmerston North, NZ	1
Smithfield, AU	1
JBRJlocation not on record	1

36 institutions · 800 of 810 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epilobium hirtigerum

At a glance

Sources7 archives

Size & morphology18

Life cycle & reproduction11

Diet & foraging1

Habitat & environment13

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type4 181 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 36 geolocated

Cultivated / Captivenot free-living

Record type4 181 records