Epilobium hirsutum
speciesAt a glance
Occurrence records699 063
Data sources14
Biological traits70
DNA specimens50
eDNA detections26
Sources14 archives
Databases and archives Epilobium hirsutum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility699 063 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics50 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources70 traits
Chemical compositionLOTUS · NPASS244 compounds
Occurrence & distributionGBIF699 063 records
Environmental DNA1 datasets · 6 countries26 detections
DNA & barcodingBOLD · NCBI50 specimens
Genome at a glanceCCDB · GoaT · NCBI460 Mbp
01Narrative
L'épilobe à grandes fleurs, encore appelée épilobe hirsute, est une espèce de plantes à fleurs du genre Epilobium et de la famille des Onagraceae. De la souche longuement stolonifère partent chaque printemps, de nouvelles tiges dressées. L'épilobe hirsute appartient souvent à une formation végétale prairiale, constituée de grandes herbes, généralement des dicotylédones à larges feuilles, appelée mégaphorbiaie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length57.5 mm
Fruit length max90 mm
Fruit length min25 mm
Leaf length80 mm
Leaf length max130 mm
Leaf length min40 mm
Leaf mass130 mg
Leaf size1 398 mm²
⚠ sources differ — TRY: 1 398 mm² · LEDA: 2 833 mm² · GIFT: 2 833 mm²
Leaf width21.5 mm
Leaf width max40 mm
Leaf width min3 mm
Plant height0.975 m
⚠ sources differ — GIFT: 0.975 m · AusTraits: 1.5 m · LEDA: 1.15 m · TRY: 1.52 m
Plant height generative1.15 m
Plant height max2.74 m
Plant height min0.21 m
Seed length0.927 mm
⚠ sources differ — TRY: 0.927 mm · AusTraits: 1 mm
Seed mass0.112 mg
⚠ sources differ — TRY: 0.112 mg · LEDA: 0.12 mg · GIFT: 0.112 mg
Seed mass max0.138 mg
Seed mass min0.05 mg
Seed volume0.1 mm³
Seed volume max0.1 mm³
Seed volume min0.099 mm³
Life cycle & reproduction19
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower colourpink
Flower length max18 mm
Flower length min12 mm
Flowering endSep
Flowering startJun
Flowering timenynnnnnnnnnn
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number23 660
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 200 m
Elevation mean1 250 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTrivers, swamps
Leaf compoundnesssimple
Leaf formlinear
Leaf shapelanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio15.69 g/g
Leaf c421 mg/g
Leaf dry-matter content (LDMC)214 mg/g
Leaf n31.07 mg/g
Leaf p3.4 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)26.75 mm²/mg
Wood density189 mg/cm³
Other traits2
Diaspore typegerminule
Shoot orientationerect
03Chemical composition244 compounds
Compounds documented for Epilobium hirsutum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavanones37
Flavonols31
Quinolizidine alkaloids18
Pterocarpan15
Gallotannins13
Documented compounds244 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((2R,3R,4S,5R,6R)-2,5-dihydroxy-6-(hydroxymethyl)-3-(3,4,5-trihydroxybenzoyl)oxy-tetrahydropyran-4-yl) 3,4,5-trihydroxybenzoate | present | LOTUS | |
| (+)-12alpha-Hydroxysophocarpine | present | NPASS | |
| (+)-Lupanine | present | NPASS | |
| (+)-Maackiain | present | NPASS | |
| (+)-Medicarpin | present | NPASS | |
| (+)-Sophoranol | present | NPASS | |
| (-)-14beta-Hydroxymatrine | present | NPASS | |
| (-)-9alpha-Hydroxysophocarpine | present | NPASS | |
| (-)-Maackiain | present | NPASS | |
| (-)-maackiain-3-O-glucoside | present | NPASS |
05DNA & barcoding50 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium hirsutum has left across the world's sequence archives.
At a glance
DNA specimens50
Marker genes7
GenBank sequences10
eDNA detections26
Countries8
The DNA barcodea real sequence read deposited for this species
ATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCATTTGGCCGAGGGCACGT …
Epilobium hirsutum isolate D44 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2atpF-atpHrpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Epilobium hirsutum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size459 660 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Epilobium hirsutum0.46 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× diploid · measured
Chromosome records18–542n range36median36mode50records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3642×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Raven, P.H., Moore, D.M. Watsonia 6: 36-38 (1964)
CCDB · brit-fl — Thakur, V. (1965)
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. XII. Onagraceae Queirs, M.Bol. Soc. Brot. ser. 250: 107-116(1976).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3046
CCDB · poland — Izmai?ow R. 1977. Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20, 101-111.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chromosome numbers in some species of vascular plants from Byelorussia. Bot. Zhurn. SSSR 71: 1145–1147.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — GERVAIS, C. 1979a. Liste annotee de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique. Naturaliste Canad. 106: 451–461.
CCDB · book-ipcn75-78 — Izmailow 1977
CCDB · book-ipcn75-78 — Queiros 1976
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-indian_vol1 — Hakansson, A. 1924; Schwemmle, J. 1924; Michaelis, P. 1925; Tischler, G. 1934; Love, A. & Love, D. 1942 b ; Raven, P. H. & Moore, D. M. 1964, Gadella, T.W.J. & Kliphuis, E. 1966, 1968a; Podlech, D. & Dieterle, A. 1969; Van Loon, J. Chr. & Kieft, B. 1980
CCDB · eflora
CCDB · book-fedorov — HAkansson 1924h
CCDB · book-fedorov — Michaelis P. 1925
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Raven, Moore 1964
CCDB · book-fedorov — Gadella, Kliphuis 1966
CCDB · kew — Mowforth MA.1986. Variation in nuclear DNA amounts in flowering plants: an ecological analysis. PhD. Thesis, University of Sheffield. Specific reference for Poa annua in Mowforth MA and Grime JP. 1989. Intra-Population Variation in Nuclear DNA Amount
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1986a). Chromosome numbers in some species of vascular plants from Byelorussia. Bot. Žurn. 71: 1145-1147.
CCDB · CromoCat 2015 — Douwes, H. (1946). Plasma, polyploidie en celgrootte. Over reciproke verschillenbij bastaarden van tri en tetraploide rassen van Epilobium hirsutum. Genetica 24: 161-198.
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1966). Chromosome numbers of flowering plants in the Netherlands II. Proc. Kon. Ned. Akad. Wetensch. Ser. C 69(5): 541-556.
CCDB · CromoCat 2015 — Gagnieu, A. & Linder, R. (1954). Material pour expérimentation et démonstration. Jard. Bot. Strasbourg. Index Seminum 1954: 13-16.
CCDB · CromoCat 2015 — Gagnieu, A. & Linder, R. (1955). Material pour expérimentation et démonstration. Jard. Bot. Strasbourg. Index Seminum 1955: 19-22.
CCDB · CromoCat 2015 — Gervais, C. (1979). Liste annotée de nombres chromosomiques de la flore vasculaire du Nord-Est de l'Amérique. Naturaliste Canad. 106: 451-461.
CCDB · CromoCat 2015 — Hakansson, A. (1924). Beiträge zur Zytologie eines Epilobium-Bastardes. Bot. Not. 77: 269-278.
CCDB · CromoCat 2015 — Izmailow R. (1977). Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20(1-2): 101-111.
CCDB · CromoCat 2015 — Kisch, R. (1941). Morphologie und zytologie haploider pflanzen von Epilobium hirsutum. Z. Bot. 36: 513-537.
CCDB · CromoCat 2015 — Loon van, J. C. & Kieft, B. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 538-542. si
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Michaelis, P. (1925). Zur Cytologie und Embryoentwicklung von Epilobium. Ber. Deutsch. Bot. Ges. 43: 61-67.
CCDB · CromoCat 2015 — Michaelis, P. (1926). Uber den Einfluss der Kälte auf die Reduktionsteilung von Epilobium. Planta 1: 569-582.
CCDB · CromoCat 2015 — Podlech, D. & A. Dieterle. (1969). Chromosomenstudien an afghanischen Pflanzen. Candollea 24(2): 185-243.
CCDB · CromoCat 2015 — Probatova, N. S., A. P. Sokolovskaya & E. G. Rudyka. (1991). Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žurn. 76: 1174-1178.
CCDB · CromoCat 2015 — Queirós, M. (1976). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. XII. Onagraceae. Bol. Soc. Brot. 50: 107-116.
CCDB · CromoCat 2015 — Schwemmle, J. (1924). Vergleichend zytologische untersuchungen an Onagraceen. Ber. Deutsch. Bot. Ges. 42: 238-243.
+1 more references
2n 544×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · book-indian_vol1 — Michaelis, P. 1928
CCDB · book-fedorov — Michaelis P. 1928
CCDB · CromoCat 2015 — Michaelis, P. (1928). Uber die Experimentelle Erzeugung heteroploider Pflanzen bei Epilobium und Oenothera. Biol. Zentralbl. 48: 370-374.
CCDB · CromoCat 2015 — Michaelis, P. (1942). Uber reziprok verschiedene Sippenbastarde bei Epilobium hirsutum. V. Uber die Bedeutung der Genquantität für die Manifestation reziproker Unterschiede. Z. Vererb. 80: 429-453.
2n 383×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.
CCDB · CromoCat 2015 — Gervais, C. (1979). Liste annotée de nombres chromosomiques de la flore vasculaire du Nord-Est de l'Amérique. Naturaliste Canad. 106: 451-461.
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977b). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195-200.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
n 185×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.
CCDB · CromoCat 2015 — Hair, J. B., Raven, P. H. & Seavey, S. R. (1977). Cytological affinities of the Australasian species of Epilobium (Onagraceae). New Zealand J. Bot. 15: 1-4.
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977b). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195-200.
CCDB · CromoCat 2015 — Jeelani, R. M., Kumari, S. & Gupta, R. C. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1788-1789
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kaur, D. & Singhal, V. K (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:894-895
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness94.6% BUSCO
08Occurrence & distribution
Record type699 063 records
Wild obs. + sensor687 080
Museum / vouchered10 939
Cultivated / captive50
Other994
Origin
Native41 518
Introduced122
Range
Area of Occupancy AOO539 344 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 173 637≤1 km 121 979≤10 km 287 322>10 km 3 504
586 442 georeferenced · 100 638 without coordinates
Open the mapobservation + sensor687 080
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 515≤1 km 1 628≤10 km 2 962>10 km 499
5 604 georeferenced · 5 335 without coordinates
Open the institutions mapphysical evidence10 939
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 17>10 km 13
30 georeferenced · 20 without coordinates
Open the mapnot free-living50
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions149 of 296 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 393 |
| BIO-UNIPIlocation not on record | 492 |
| LDlocation not on record | 402 |
| Moscow State Universitylocation not on record | 398 |
| Helsinki, FI | 376 |
| Beijing, CN | 367 |
| BFLlocation not on record | 292 |
| BRNUlocation not on record | 287 |
| MeiseBGlocation not on record | 217 |
| Yangling, CN | 142 |
| MAlocation not on record | 128 |
| Kunming, CN | 119 |
| Olocation not on record | 119 |
| Pretoria, ZA | 113 |
| Berlin, DE | 103 |
| Oskarshamn, SE | 100 |
| Adam Mickiewicz University in Poznańlocation not on record | 99 |
| València, ES | 96 |
| Görlitz, DE | 91 |
| Tartu, EE | 91 |
| Entomological Society of Latvialocation not on record | 82 |
| Turku, FI | 80 |
| IFR-DNFlocation not on record | 78 |
| SLU Artdatabankenlocation not on record | 70 |
| Nanjing, CN | 70 |
| Salzburg, AT | 67 |
| Chengdu, CN | 65 |
| WNNUlocation not on record | 60 |
| Uniwersytet Warszawskilocation not on record | 60 |
| BDBClocation not on record | 58 |
| Oulu, FI | 56 |
| Oregon State Universitylocation not on record | 54 |
| Chongqing Museumlocation not on record | 54 |
| Chengdu, CN | 52 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 50 |
| Barcelona, ES | 50 |
| South Kensington, GB | 50 |
| Provincia di Livornolocation not on record | 49 |
| Tsukuba, JP | 46 |
| DBF-NHMDlocation not on record | 45 |
| Córdoba, ES | 45 |
| Québec, CA | 44 |
| Uppsala, SE | 42 |
| Guangzhou, CN | 42 |
| Philadelphia, US | 38 |
| Tallinn, EE | 37 |
| Karlsruhe, DE | 37 |
| BClocation not on record | 35 |
| Xining, CN | 35 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 33 |
| Christchurch, NZ | 32 |
| KMNlocation not on record | 32 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 30 |
| Ann Arbor, US | 29 |
| College of the Atlantic, Museumlocation not on record | 29 |
| Salamanca, ES | 28 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 28 |
| Badajoz, ES | 28 |
| Madison, US | 28 |
| Saint Louis, US | 27 |
| Guilin, CN | 27 |
| Vitoria, ES | 27 |
| CICYTEXlocation not on record | 26 |
| Museo Entomologico de Leonlocation not on record | 26 |
| Wlocation not on record | 25 |
| GMBAlocation not on record | 25 |
| Philadelphia, US | 25 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 25 |
| WTUlocation not on record | 24 |
| Madrid, ES | 24 |
| Mlocation not on record | 23 |
| Bronx, US | 23 |
| UGentlocation not on record | 23 |
| Bergen, NO | 23 |
| Granada, ES | 22 |
| Dresden, DE | 21 |
| GJOlocation not on record | 21 |
| TUR-Alocation not on record | 20 |
| Seoul, KR | 19 |
| Bern, CH | 19 |
| Toronto, CA | 18 |
| Voronezh State Universitylocation not on record | 18 |
| Kew, GB | 18 |
| Phyletisches Museum Jenalocation not on record | 17 |
| Pamplona, ES | 17 |
| Wuhan, CN | 17 |
| Université Lavallocation not on record | 17 |
| Kuopio, FI | 15 |
| Montréal, CA | 15 |
| CJBGlocation not on record | 15 |
| Yunnan Universitylocation not on record | 15 |
| Wuhan, CN | 15 |
| Natural History Museum Rotterdamlocation not on record | 14 |
| Porrentruy, CH | 14 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 14 |
| Alicante, ES | 14 |
| Xinxiang, CN | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Denver, US | 13 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| Uniwersytet Śląski w Katowicachlocation not on record | 12 |
| Urumqi, CN | 12 |
| Frankfurt am Main | 12 |
| McWane Science Centerlocation not on record | 12 |
| Jyväskylä, FI | 11 |
| Paris, FR | 11 |
| Lanzhou, CN | 11 |
| Urumqi, CN | 11 |
| University of New Hampshirelocation not on record | 11 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 10 |
| University of Stellenboschlocation not on record | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Shanxi Institute of Biologylocation not on record | 10 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 10 |
| Stockholm, SE | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| ISAlocation not on record | 9 |
| Staten Island, US | 9 |
| Jaén, ES | 9 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 8 |
| Tilburg, NL | 8 |
| Cape Town, ZA | 8 |
| Saint John, CA | 8 |
| New Haven, US | 8 |
| Podgorica, ME | 8 |
| Acadia Universitylocation not on record | 8 |
| Burlington, US | 8 |
| Zhengzhou, CN | 8 |
| Changsha, CN | 8 |
| Wellington, NZ | 7 |
| Bourges, FR | 7 |
| Pamplona, ES | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Bloomington, US | 7 |
| Frauenfeld, CH | 7 |
| Canberra, AU | 7 |
| Pullman, US | 7 |
| Chengdu, CN | 7 |
| Porvoo, FI | 7 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 7 |
| Guiyang, CN | 7 |
| PRClocation not on record | 6 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 6 |
| Tianjin Natural History Museumlocation not on record | 6 |
| Taipei, TW | 6 |
| Green Bay, US | 6 |
| Vancouver, CA | 6 |
| Xian, CN | 6 |
| Durban, ZA | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Corvallis, US | 6 |
| Xian, CN | 6 |
| Edinburgh, GB | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| BSBIlocation not on record | 5 |
| OLAlocation not on record | 5 |
| Strecker Museum, Baylor Universitylocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Uniwersytet Opolskilocation not on record | 5 |
| KR | 5 |
| Provo, US | 5 |
| Xiamen, CN | 5 |
| Mount Annan, AU | 4 |
| Awka, NG | 4 |
| JBSlocation not on record | 4 |
| Sion, CH | 4 |
| Dekalb, US | 4 |
| Guiyang, CN | 4 |
| Hobart, AU | 4 |
| Hazara Universitylocation not on record | 4 |
| Zürich, CH | 4 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 4 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 4 |
| Tula State Universitylocation not on record | 4 |
| Trondheim, NO | 4 |
| Nanchong, CN | 3 |
| Banyoles, ES | 3 |
| Beijing Natural History Museumlocation not on record | 3 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 3 |
| Hebei Normal Universitylocation not on record | 3 |
| Fulda, DE | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| ZRC-SAZUlocation not on record | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| UoB-IBlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Keene State Universitylocation not on record | 3 |
| Guangzhou, CN | 3 |
| Shanghai, CN | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Mount Pleasant, US | 3 |
| BGBMlocation not on record | 3 |
| EMTCMlocation not on record | 3 |
| Miami, US | 3 |
| EEZA-CSIClocation not on record | 3 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 2 |
| Central China Agricultural Universitylocation not on record | 2 |
| Whitehorse, CA | 2 |
| Wuzhou, CN | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Monastir, TN | 2 |
| Bangkok, TH | 2 |
| Victoria, CA | 2 |
| Davenport, US | 2 |
| CRSN_LWIROlocation not on record | 2 |
| Sevilla, ES | 2 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 2 |
| PrivatHerblocation not on record | 2 |
| Durham, US | 2 |
| Moscow, US | 2 |
| National Museums of Kenyalocation not on record | 2 |
| Auckland, NZ | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| ASUlocation not on record | 2 |
| Boumlocation not on record | 2 |
| FLADlocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| B.A. Bennett Herbariumlocation not on record | 2 |
| Chicago, US | 2 |
| BJUlocation not on record | 2 |
| SXTCMlocation not on record | 2 |
| UIBlocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Oswego, US | 2 |
| Philadelphia, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| SGAV-and-NHMDlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| ENTClocation not on record | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Guangxi Agricultural Universitylocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Adelaide, AU | 1 |
| Elocation not on record | 1 |
| Namur, BE | 1 |
| Sede dell'Orto botanico del Museo di Storia naturale dell'Università degli Studi di Parmalocation not on record | 1 |
| Boise, US | 1 |
| CASlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Plocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Göteborg, SE | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| Fargo, US | 1 |
| Nijmegen, NL | 1 |
| Glarus, CH | 1 |
| Millersville, US | 1 |
| Trois-Rivières, CA | 1 |
| Clemson, US | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Riverside, US | 1 |
| Fukushima Universitylocation not on record | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| San Luis Obispo, US | 1 |
| JBRJlocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Washington, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Portland, US | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Zürich, CH | 1 |
| ESP109location not on record | 1 |
| Logan, US | 1 |
| ROM020location not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Nishihara, JP | 1 |
| Rovaniemi, FI | 1 |
| Hangzhou, CN | 1 |
| Emporia, US | 1 |
| Gijón, ES | 1 |
| Caldwell, US | 1 |
| Jackson, US | 1 |
| Tacoma, US | 1 |
| Brussel, BE | 1 |
| Umeå Universitylocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| GZUlocation not on record | 1 |
| Flagstaff, US | 1 |
| Rishon Le Zion, IL | 1 |
| TROMlocation not on record | 1 |
| POL003location not on record | 1 |
| ESP010location not on record | 1 |
| HUN003location not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
296 institutions · 9 810 of 10 939 vouchered records shown · 887 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Epilobium hirsutum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map6 countries0
at edge of pondcliffs, talus slopes, and gravel banksDisturbed ground near trail; ditch.occasional on open rocky bluffs above Fraser…Disturbed meadow in townsite.on mossy knoll, E-facing, not common
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.1 °C 13.6–17.8
Seasonal swing summer↔winter13.9 °C
Max temp (day)18.1 °C 15.5–22.6
Min temp (night)11.7 °C 11.2–14.9
Precipitation75.6 mm/mo 39.9–85.6
Air humidity62.9 % 56.6–63.2
Moisture balance-40.9 mm/mo -75.2–3.70
Vapour deficit675 Pa 573–909
Wind speed4.70 m/s 3.00–6.20
Cloud cover50.2 % 35.2–55.0
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.