Epilobium glabellum

G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records1 337

Data sources5

Biological traits3

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Epilobium glabellum's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 337 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF1 337 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 36

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.043 mg

Life cycle & reproduction1

Life formsubshrub

Habitat & environment1

Climatesubalpine or subarctic

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium glabellum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSEF416614.1 ↗610 bp

ACGT

GTCGAATCCTGCATAGCAGAACAACCCGAGAACCGGTTCACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCT …

Epilobium glabellum voucher AK298210 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium glabellum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · new-zealand · CCDB · book-ipcn75-78 · CCDB · book-fedorov

CCDB · new-zealand

CCDB · book-ipcn75-78 — Hair 1977

CCDB · book-fedorov — Hair 1942

n 181×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Hair 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 337 records

Wild obs. + sensor746

Museum / vouchered591

Origin

Native1

Range

Area of Occupancy AOO2 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 495≤1 km 95≤10 km 30>10 km 7

627 georeferenced · 119 without coordinates

Open the mapobservation + sensor746

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 1≤1 km 12≤10 km 22>10 km 3

38 georeferenced · 553 without coordinates

Open the institutions mapphysical evidence591

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	283
Auckland, NZ	160
Christchurch, NZ	106
Rotorua, NZ	10
Bronx, US	5
Hobart, AU	5
Armidale, AU	5
Kew, GB	2
Adelaide, AU	2
LDlocation not on record	2
Flagstaff, US	1
Provo, US	1
Turlock, US	1
Mount Annan, AU	1
Chicago, US	1
Museo Entomologico de Leonlocation not on record	1
University of Stellenboschlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Edinburgh, GB	1
Smithfield, AU	1

20 institutions · 590 of 591 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epilobium glabellum

At a glance

Sources5 archives

Size & morphology1

Life cycle & reproduction1

Habitat & environment1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 337 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 20 geolocated

Record type1 337 records