Epilobium brunnescens

(Cockayne) P.H.Raven & Engelhorn · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Onagraceae/Epilobium

At a glance

Occurrence records29 274

Data sources10

Biological traits37

DNA specimens11

eDNA detections4

Sources10 archives

Databases and archives Epilobium brunnescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources37 traits

Occurrence & distributionGBIF29 274 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB352 Mbp

01Narrative

Epilobium brunnescens is a flowering plant belonging to the willowherb genus Epilobium in the family Onagraceae. It is a small, creeping, perennial plant with white or pale pink flowers. It is native to New Zealand and south-east Australia and has been introduced to Northern Europe. Its common names include New Zealand willowherb in Great Britain and Ireland, creeping willowherb in New Zealand and bog willowherb for the Australian subspecies.Stace, Clive (2010) New Flora of the British Isles, 3rd edition, Cambridge University Press.New Zealand Plants: Epilobium brunnescens (Cockayne) P.H.Raven & Engelhorn. Accessed 14 April 2013.Carter, Oberon & Neville Walsh (2006) National Recovery Plan for the Bog Willow-herb Epilobium brunnescens subspecies beaugleholei , State of Victoria Department of Sustainability and Environment.Webb, D.A., Parnell, J. and Doogue, D. 1996. An Irish Flora. Dundalgan Press (W. Tempest)Ltd. Dundalk.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYAusTraitsWCVP

Size & morphology14

Fruit length40 mm

Leaf length max7 mm

Leaf size32 mm²

Leaf width6 mm

Leaf width max6 mm

Leaf width min6 mm

Plant height0.14 m

Plant height max0.2 m

Seed length0.7 mm

⚠ sources differ — TRY: 0.7 mm · GIFT: 0.9 mm

Seed length max0.9 mm

Seed length min0.9 mm

Seed mass0.032 mg

⚠ sources differ — TRY: 0.032 mg · AusTraits: 0.032 mg · GIFT: 0 mg

Seed mass max0 mg

Seed mass min0 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

Life formsubshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualpresent

Seed number119

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTLowland

Mycorrhiza type0.0000127

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium brunnescens has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes3

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF416598.1 ↗610 bp

ACGT

GTCGAATCCTGCATAGCAGAACAACCCGAGAACCGGTTAACAACCAGTTGGGAGACGGGGGCATCGCCCCTTGCGCTCACAAACCCCGCT …

Epilobium brunnescens voucher AK298104 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS9★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Epilobium brunnescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size352 080 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Epilobium brunnescens0.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidydiploid inferred

Chromosome records36–362n range36median36mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 365×CCDB · new-zealand · CCDB · nw-europe-fl · CCDB · book-ipcn75-78

CCDB · new-zealand

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3057

CCDB · book-ipcn75-78 — Hair 1977

n 181×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Hair 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type29 274 records

Wild obs. + sensor29 156

Museum / vouchered116

Other2

Origin

Native129

Introduced4 665

Range

Area of Occupancy AOO42 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 4 590≤1 km 9 764≤10 km 14 583>10 km 15

28 952 georeferenced · 204 without coordinates

Open the mapobservation + sensor29 156

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 7≤1 km 12≤10 km 2>10 km 8

29 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence116

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	47
Wellington, NZ	17
Royal Botanic Garden Edinburghlocation not on record	6
South Kensington, GB	5
AADClocation not on record	5
BSBIlocation not on record	4
Olocation not on record	4
Bergen, NO	4
MAlocation not on record	3
Kew, GB	3
Auckland, NZ	3
Moscow State Universitylocation not on record	2
Provincia di Livornolocation not on record	2
Flagstaff, US	1
CBDClocation not on record	1
BRNUlocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Hobart, AU	1
Parkville, AU	1
MeiseBGlocation not on record	1
Jaén, ES	1
Sevilla, ES	1
Adam Mickiewicz University in Poznańlocation not on record	1

23 institutions · 115 of 116 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Epilobium brunnescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

quarrySlopes on a stream by the bridge

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 13.8–15.2

Seasonal swing summer↔winter9.30 °C

Max temp (day)16.7 °C 16.3–17.0

Min temp (night)12.2 °C 10.7–13.9

Precipitation101 mm/mo 94.8–108

Air humidity65.0 % 64.0–66.1

Moisture balance-3.60 mm/mo -5.60–-1.70

Vapour deficit576 Pa 569–582

Wind speed3.70 m/s 3.40–4.10

Cloud cover48.8 % 48.3–49.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epilobium brunnescens

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction10

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type29 274 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type29 274 records