Epilobium anagallidifolium
Lam. · speciesAt a glance
Occurrence records20 163
Data sources12
Biological traits38
DNA specimens23
eDNA detections13
Sources12 archives
Databases and archives Epilobium anagallidifolium's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility20 163 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics23 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Occurrence & distributionGBIF20 163 records
Environmental DNA1 datasets · 4 countries13 detections
DNA & barcodingBOLD · NCBI23 specimens
Genome at a glanceCCDB · GoaT2n = 36
01Narrative
Epilobium anagallidifolium is a species of willowherb known by the common names pimpernel willowherb and alpine willowherb. This small flowering plant has a near-circumboreal distribution and can be found in mountain ranges further south, where grows in alpine climates. It is a perennial found in low clumps rarely exceeding 20 centimeters in height.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Fruit length26.5 mm
Fruit length max36 mm
Fruit length min17 mm
Leaf mass1.13 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · LEDA: 23.57 mm² · GIFT: 23.78 mm²
Plant height0.059 m
⚠ sources differ — GIFT: 0.059 m · LEDA: 0.055 m · TRY: 0.04 m
Plant height generative0.07 m
Plant height max0.1 m
Plant height min0.04 m
Seed length1.02 mm
Seed mass0.063 mg
Seed mass max0.07 mg
Seed mass min0.06 mg
Life cycle & reproduction9
Deciduousnessevergreen
Dispersal typewater
Flowering endAug
Flowering startJul
Life formperennial or subshrub
Life spanperennial
Lifespan years3 years
Raunkiær life formhemicryptophyte
Seed number84.75
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation mean1 400 m
Elevation min1 300 m
Epiphyteterrestrial
Growth formherb
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)304 mg/g
⚠ sources differ — TRY: 304 mg/g · LEDA: 345 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)23.54 mm²/mg
⚠ sources differ — TRY: 23.54 mm²/mg · LEDA: 21.31 mm²/mg · GIFT: 21.31 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding23 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epilobium anagallidifolium has left across the world's sequence archives.
At a glance
DNA specimens23
Marker genes6
GenBank sequences10
eDNA detections13
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCATTTGGCCGAGGGCACGTCTGCCTGGGCGTCAATCATC …
Epilobium anagallidifolium voucher RBGE81 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★rbcLa★trnL-F★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Epilobium anagallidifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidydiploid inferred
Chromosome records18–362n range36median36mode35records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3633×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Uhríková A., Paclová L. & Dúbravcová Z., 1980: [Report], pp. 730. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · brit-fl — Raven, P.H., Moore, D.M. Watsonia 6: 36-38 (1964)
CCDB · brit-fl — Thakur, V. (1965)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3055
CCDB · fl-europaea — Raven & Moore,
CCDB · poland — Skali?ska M., Pogan E. et al. 1966. Further studies in chromosome numbers of Polish Angiosperms. Sixth contribution. Acta Biol. Cracov. Ser. Bot. 9, 31-58.
CCDB · poland — Izmai?ow R. 1977. Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20, 101-111.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1982. Chromosome numbers of some plant species of north-eastern Asia. Bot. Zhurn. SSSR 67 (3): 360–365.
CCDB · ipcn-api-dl — Nikolov, N. A. 1991. Chromosome numbers of Bulgarian angiosperms from North Pirin Mountain: Reserve "Bajuvi Dupki--D|3zind|3zirica". Fitologija 41: 70–75.
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977a. Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195–200.
CCDB · ipcn-api-dl — Uhrikova, A., L. Paclova & Z. Dubravcova. 1980. In Chromosome number reports LXIX. Taxon 29:730.
CCDB · book-ipcn66 — Skalinska et al. 1966
CCDB · book-ipcn67-71 — KNABEN, G. 1968. Chromosome numbers of flowering plants from Central Alaska. Nytt mag. bot. 15: 240-254.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · eflora
CCDB · book-fedorov — Bacher 1938a
CCDB · book-fedorov — CoKOJIOBCKaH, CrpenRona 1948a
CCDB · book-fedorov — Bacher, Larsen 1950
CCDB · book-fedorov — LOve A., LOve D. 1956b
CCDB · book-fedorov — Packer 1964
CCDB · book-fedorov — Raven, Moore 1964
CCDB · book-fedorov — Urbaiiska-Worytkiewicz (Skaliiiska et al. 1966)
CCDB · book-atlas-flowering-plants — B0cher & L. 1950
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Izmailow R. (1977). Cytological studies in Polish representatives of the genus Epilobium L. Acta Biol. Cracov. Ser. Bot. 20(1-2): 101-111.
CCDB · CromoCat 2015 — Nikolov, N.A. (1991). Chromosome numbers of Bulgarian Angiosperms from North Pirin mountain Fitologija 41: 70-75.
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977a). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107-119.
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977b). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195-200.
CCDB · CromoCat 2015 — Uhríková, A., L. Paclová & Z. Dúbravcová. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 730.
CCDB · CromoCat 2015 — Zhukova, P. G. (1982). Chromosome numbers of some north-eastern Asia plant species. Bot. Žurn. 67: 360-365.
2n 182×CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · book-fedorov — Mattick (T. 1950)
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
n 187×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977. Chromosomal evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107–119.
CCDB · ipcn-api-dl — Seavey, S. R. & P. H. RAVEN. 1977a. Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195–200.
CCDB · ipcn-api-dl — Uhrikova, A., L. Paclova & Z. Dubravcova. 1980. In Chromosome number reports LXIX. Taxon 29:730.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977a). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae). Pl. Syst. Evol. 127: 107-119.
CCDB · CromoCat 2015 — Seavey, S. R. & Raven, P. H. (1977b). Chromosome evolution in Epilobium sect. Epilobium (Onagraceae), II. Pl. Syst. Evol. 128: 195-200.
CCDB · CromoCat 2015 — Uhríková, A., L. Paclová & Z. Dúbravcová. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 730.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type20 163 records
Wild obs. + sensor16 402
Museum / vouchered3 604
Other157
Origin
Native1 531
Range
Area of Occupancy AOO37 856 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 3 833≤1 km 2 938≤10 km 6 768>10 km 228
13 767 georeferenced · 2 635 without coordinates
Open the mapobservation + sensor16 402
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 324≤1 km 792≤10 km 908>10 km 225
2 249 georeferenced · 1 355 without coordinates
Open the institutions mapphysical evidence3 604
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions97 of 172 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 356 |
| Trondheim, NO | 268 |
| TROMlocation not on record | 225 |
| LDlocation not on record | 164 |
| Salzburg, AT | 131 |
| Victoria, CA | 126 |
| Bergen, NO | 124 |
| Garðabær, IS | 106 |
| Helsinki, FI | 106 |
| BFLlocation not on record | 85 |
| KMNlocation not on record | 81 |
| WTUlocation not on record | 70 |
| Québec, CA | 68 |
| Pullman, US | 67 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 55 |
| GJOlocation not on record | 54 |
| Uniwersytet Wrocławskilocation not on record | 52 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 47 |
| Zürich, CH | 45 |
| Corvallis, US | 45 |
| Chicago, US | 44 |
| Oskarshamn, SE | 44 |
| Moscow, US | 42 |
| Madison, US | 39 |
| Oulu, FI | 37 |
| Vancouver, CA | 35 |
| Barcelona, ES | 34 |
| Toyama, JP | 33 |
| Zürich, CH | 32 |
| Missoula, US | 31 |
| MAlocation not on record | 29 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 27 |
| Turku, FI | 26 |
| Entomological Society of Latvialocation not on record | 26 |
| Denver, US | 25 |
| 25 | |
| Tsukuba, JP | 25 |
| CJBGlocation not on record | 25 |
| Moscow State Universitylocation not on record | 24 |
| Bozeman, US | 24 |
| Provincia di Livornolocation not on record | 22 |
| University of Alberta Museumslocation not on record | 21 |
| BRNUlocation not on record | 21 |
| SLU Artdatabankenlocation not on record | 21 |
| Claremont, US | 18 |
| Montréal, CA | 18 |
| BDBClocation not on record | 16 |
| Kuopio, FI | 16 |
| JP | 16 |
| Caldwell, US | 15 |
| Uppsala, SE | 15 |
| Glarus, CH | 15 |
| Bern, CH | 14 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 13 |
| Rocky Mountain Biological Laboratorylocation not on record | 13 |
| Davis, US | 13 |
| TUR-Alocation not on record | 13 |
| Durango, US | 12 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 12 |
| University of Stellenboschlocation not on record | 12 |
| Mlocation not on record | 11 |
| DOI/NPS, Greenbelt Parklocation not on record | 11 |
| Wlocation not on record | 11 |
| Anchorage, US | 10 |
| Whitehorse, CA | 8 |
| Université Lavallocation not on record | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| BIO-UNIPIlocation not on record | 8 |
| Tacoma, US | 8 |
| Albuquerque, US | 8 |
| nbflocation not on record | 7 |
| South Kensington, GB | 7 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| Boise, US | 7 |
| Pittsburg, US | 6 |
| Tromso University Museumlocation not on record | 6 |
| Pocatello, US | 6 |
| Angwin, US | 6 |
| Chongqing Museumlocation not on record | 6 |
| Flagstaff, US | 6 |
| BClocation not on record | 4 |
| St. Paul, US | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| Bloomington, US | 4 |
| Arcata, US | 4 |
| Porrentruy, CH | 4 |
| Riverside, US | 4 |
| Berlin, DE | 4 |
| Sendai, JP | 4 |
| Yukon Universitylocation not on record | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| CASlocation not on record | 3 |
| Frankfurt am Main | 3 |
| Bourges, FR | 3 |
| Lausanne, CH | 3 |
| Jyväskylä, FI | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| Paris, FR | 3 |
| Trois-Rivières, CA | 2 |
| Dresden, DE | 2 |
| Porvoo, FI | 2 |
| Rovaniemi, FI | 2 |
| Salamanca, ES | 2 |
| Provo, US | 2 |
| Vitoria, ES | 2 |
| Montréal, CA | 2 |
| Emporia, US | 2 |
| GZUlocation not on record | 2 |
| Badajoz, ES | 2 |
| Sion, CH | 2 |
| Fukushima Universitylocation not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| San Jose, US | 2 |
| Saint John, CA | 2 |
| Northridge, US | 2 |
| LfUlocation not on record | 2 |
| Stockholm, SE | 2 |
| Granada, ES | 2 |
| Herb. BBGlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Chengdu, CN | 2 |
| Acadia Universitylocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| University of Hulllocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Karlsruhe, DE | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Los Angeles, US | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| NMWlocation not on record | 1 |
| Bronx, US | 1 |
| Nishihara, JP | 1 |
| CICYTEXlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| WNNUlocation not on record | 1 |
| Wuhan, CN | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Dekalb, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Orem, US | 1 |
| Durham, US | 1 |
| València, ES | 1 |
| Nanjing, CN | 1 |
| Burlington, US | 1 |
| Nagano City, JP | 1 |
| Madrid, ES | 1 |
| Finnish Museum of Natural Historylocation not on record | 1 |
| Kew, GB | 1 |
| Wellington, NZ | 1 |
| Pomona Collegelocation not on record | 1 |
| Ann Arbor, US | 1 |
| San Diego, US | 1 |
| Fort Worth, US | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| PRClocation not on record | 1 |
| Columbia, US | 1 |
| Pamplona, ES | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| SZUlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Logan, US | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
172 institutions · 3 542 of 3 604 vouchered records shown · 62 without an institution code
09Environmental DNA13 detections
Where the DNA of Epilobium anagallidifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map4 countries0
Mesic Dwarf Shrub Tundra dominated by Empetr…Montane
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.8 °C 8.30–12.9
Seasonal swing summer↔winter20.8 °C
Max temp (day)13.2 °C 10.9–16.7
Min temp (night)6.90 °C 4.80–8.50
Precipitation110 mm/mo 77.2–150
Air humidity64.6 % 60.8–69.2
Moisture balance11.0 mm/mo -17.2–70.5
Vapour deficit450 Pa 355–651
Wind speed4.20 m/s 2.50–5.70
Cloud cover59.6 % 40.6–64.4
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.