Epigaea asiatica

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Epigaea

At a glance

Occurrence records663

Data sources9

Biological traits5

DNA specimens8

eDNA detections4

Sources9 archives

Databases and archives Epigaea asiatica's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility663 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Chemical compositionNPASS6 compounds

Occurrence & distributionGBIF663 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Epigaea asiatica is a species of Epigaea from Japan. Seeds are dispersed by ants.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

03Chemical composition6 compounds

Compounds documented for Epigaea asiatica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones1

Aromadendrane sesquiterpenoids1

Cadinane sesquiterpenoids1

Humulane sesquiterpenoids1

Caryophyllane sesquiterpenoids1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(1aR,4R,4aR,7S,7aS,7bS)-1,1,4,7-tetramethyl-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulen-4-ol	present	NPASS
(1R,3E,7E,11R)-3,7,10,10-tetramethyl-12-oxabicyclo[9.1.0]dodeca-3,7-diene	present	NPASS
(3S,4aR,5R)-3,8-dimethyl-5-propan-2-yl-4,4a,5,6-tetrahydro-3H-naphthalen-2-one	present	NPASS
(6R,11S)-3-ethyl-4,10-dimethyl-11-(3-methylbut-2-enyl)-2-oxaspiro[5.5]undeca-3,9-diene-1,5-dione	present	NPASS
5-Hydroxy-7,8-dimethoxyflavone	present	NPASS
Caryophyllene oxide	present	NPASS

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epigaea asiatica has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes4

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLC651265.1 ↗799 bpJapan · 2011

ACGT

GTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCTAGCAGAAAACTCGCGAACTTGGCTTACACAATGGGGATTGCGTGGGTTGGGCCT …

Epigaea asiatica P2653 genes for 18S rRNA, ITS1, 5.8S rRNA, ITS2, and 28S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type663 records

Wild obs. + sensor106

Museum / vouchered556

Cultivated / captive1

Range

Area of Occupancy AOO1 856 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 12≤1 km 2≤10 km 43>10 km 34

91 georeferenced · 15 without coordinates

Open the mapobservation + sensor106

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 3≤10 km 51

54 georeferenced · 502 without coordinates

Open the institutions mapphysical evidence556

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	153
Toyama, JP	57
Sanda, JP	52
Nagano City, JP	47
Shinshu Universitylocation not on record	41
Tomioka, JP	36
Bando, JP	30
KURAlocation not on record	18
JP	17
Odawara, JP	13
Hokkaido University Museumlocation not on record	12
KOMlocation not on record	10
Akita Prefectural Museumlocation not on record	9
Ishikawa Museum of Natural Historylocation not on record	8
Sendai, JP	7
FFPRIlocation not on record	5
Omachi Alpine Museumlocation not on record	4
Burlington, US	4
Nishihara, JP	4
Fukushima Universitylocation not on record	3
Iwate Prefectural Museumlocation not on record	3
Madison, US	3
SIHUlocation not on record	2
Nishihara, JP	2
Forestry and Forest Products Research Institutelocation not on record	2
Sagamihara, JP	1
Chiba, JP	1
Kochi, JP	1
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	1
Nagatoro-machi, Chichibu-gun, JP	1
Parthenon Tama History Museumlocation not on record	1
Fort Worth, US	1

32 institutions · 549 of 556 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Epigaea asiatica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 7.40–22.0

Seasonal swing summer↔winter25.2 °C

Max temp (day)16.3 °C 9.60–24.8

Min temp (night)9.90 °C 3.00–18.1

Precipitation312 mm/mo 243–344

Air humidity65.5 % 64.9–66.4

Moisture balance216 mm/mo 112–263

Vapour deficit624 Pa 428–889

Wind speed2.90 m/s 2.40–3.40

Cloud cover44.3 % 38.3–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)