Epidendrum vesicatum

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Epidendrum

At a glance

Occurrence records85

Data sources7

Biological traits12

DNA specimens4

eDNA detections2

Sources7 archives

Databases and archives Epidendrum vesicatum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF85 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Epidendrum vesicatum is an epiphytic species of orchid of the genus Epidendrum, occurring in Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max800 m

Elevation min0 m

Epiphyteobligatory

Growth formepiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epidendrum vesicatum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH218742.1 ↗878 bp

ACGT

GAAGTGTTCGGATCGCTGTGACGCGGGCGGTTTCGCCGCCCCGGGATTTTTGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAG …

Epidendrum vesicatum voucher F. Pinheiro 643 (SP) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL-like★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type85 records

Wild obs. + sensor14

Museum / vouchered71

Origin

Native40

Range

Area of Occupancy AOO204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 8≤10 km 1>10 km 3

12 georeferenced · 2 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 71 records without

Open the institutions mapphysical evidence71

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	32
INMAlocation not on record	8
Stockholm, SE	4
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Chicago, US	2
UFSCarlocation not on record	2
CEPLAClocation not on record	2
UNESClocation not on record	2
UNICAMPlocation not on record	2
Chaguaramas, TT	2
UNESP-RClocation not on record	2
Tampa, US	1
Laboratorio de Ictiologialocation not on record	1
UNESP-IBILCElocation not on record	1
Salvador, BR	1
UFPRlocation not on record	1
Criciúma, BR	1
JBRJlocation not on record	1
UNESP, Campus São José Rio Prêtolocation not on record	1
Pontifícia Universidade Católica do Paranálocation not on record	1
Departamento de Sistematica e Ecologialocation not on record	1

21 institutions · 71 of 71 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Epidendrum vesicatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)