Epidendrum porpax

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Epidendrum

At a glance

Occurrence records43

Data sources4

Biological traits10

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Epidendrum porpax's data was compiled from.

GBIFGlobal Biodiversity Information Facility43 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF43 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formepiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 700 m

Elevation min1 500 m

Epiphyteobligatory

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epidendrum porpax has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLNC_085706.1 ↗148 859 bp

ACGT

CCTGAATTCAACAAGTCAACAAGAAAGCAATCCCCCAATATCTTGTTCTAAGAACAAGATATTGGGGGATTGCTTTCTATGTTCAAAAAT …

Epidendrum porpax voucher MHLi or131 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2

plant barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor13

Museum / vouchered29

Cultivated / captive1

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 7

10 georeferenced · 3 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 10≤1 km 1≤10 km 3

14 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence29

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Chinoin, A.C.location not on record	7
Saint Louis, US	4
San Francisco, US	3
Tampa, US	3
South Kensington, GB	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Harvard Universitylocation not on record	1
Mexico City, MX	1
Chicago, US	1
Philadelphia, US	1
Cochabamba, BO	1
Station d'Ecologie de Lamtolocation not on record	1
Wlocation not on record	1
San José, CR	1
OTSlocation not on record	1

15 institutions · 29 of 29 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)