Epidendrum latilabre

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Epidendrum

At a glance

Occurrence records115

Data sources5

Biological traits12

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Epidendrum latilabre's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility115 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF115 records

DNA & barcodingNCBIsequences

01Narrative

Epidendrum latilabre is a species of orchid of the genus Epidendrum which occurs naturally in French Guiana, Peru and Brazil. The diploid chromosome number of E. latilabre has been determined as 2n = 40.as E. latilabrum, page 251 of Leonardo P. Felix and Marcelo Guerra: "Variation in chromosome number and the basic number of subfamily Epidendroideae (Orchidaceae)" Botanical Journal of the Linnean Society 163(2010)234-278. The Linnean Society of London. downloaded October 2010 from http://onlinelibrary.wiley.com/doi/10.1111/j.1095-8339.2010.01059.x/pdf

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max900 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista, Restinga

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epidendrum latilabre has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT248124.1 ↗745 bp

ACGT

CCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCGAAATATAATATCG …

Epidendrum latilabre voucher LPF 15264c small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type115 records

Wild obs. + sensor29

Museum / vouchered86

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 13≤1 km 7≤10 km 1>10 km 3

24 georeferenced · 5 without coordinates

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 1≤10 km 7

8 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Jose State University, Museum of Birds and Mammalslocation not on record	18
ESALQlocation not on record	15
Bronx, US	13
Universidade de São Paulolocation not on record	8
Stockholm, SE	6
South Kensington, GB	3
UNICAMPlocation not on record	3
UNESClocation not on record	2
Tampa, US	2
JBRJlocation not on record	2
Criciúma, BR	2
UNESP-RClocation not on record	2
Istituto Agrario Castelnuovolocation not on record	2
UFMGlocation not on record	2
Uberlândia, BR	1
Alicante, ES	1
INMAlocation not on record	1
La Paz, BO	1
herb. Vásquezlocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1

20 institutions · 86 of 86 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)