Epidendrum lacustre

Lindl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Epidendrum

At a glance

Occurrence records269

Data sources8

Biological traits11

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Epidendrum lacustre's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility269 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF269 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Epidendrum lacustre (the "lake Epidendrum) is a sympodial orchid which is known to grow both epiphytically and lithophytically in the cloud forests and rainforests of Colombia, Costa Rica, Ecuador, Nicaragua, Peru and Venezuela at altitudes ranging from 1.2—2.5 km.I. F. La Croix The new encyclopedia of orchids: 1500 species in cultivation p. 188. Timber Press, Portland, Oregon. The type of this species was found growing "on half-submerged rotten trees" in a Venezuelan marsh at an altitude of 2.4 km.H. G. Reichenbach "ORCHIDES", nr. 202 in C. Müller, Ed. Walpers. Annales Botanices Systematicae 6(1861)368. Berlin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte or lithophyte

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 600 m

Elevation min1 000 m

Epiphytefacultative

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epidendrum lacustre has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKKM495160.1 ↗779 bp

ACGT

TATGTGTCAGATCTACTAATACCCCATCCCATCCATCTGGAGAACTTGGTTCAAATCCTTCAATGCTGGATCAAAGATGTTCCTTCTTTG …

Epidendrum lacustre voucher A. Karremans 1599 (JBL) maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type269 records

Wild obs. + sensor98

Museum / vouchered169

Cultivated / captive2

Range

Area of Occupancy AOO628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 31≤1 km 21≤10 km 14>10 km 10

76 georeferenced · 22 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤1 km 4≤10 km 12>10 km 7

23 georeferenced · 146 without coordinates

Open the institutions mapphysical evidence169

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	67
Museo Nacional de Costa Rica (MNCR)location not on record	21
National Biodiversity Institute, Costa Ricalocation not on record	11
Station d'Ecologie de Lamtolocation not on record	8
Universidad del Valle (UniValle)location not on record	8
Universidad Nacional de Colombia (UNAL)location not on record	7
Aarhus, DK	5
Pontificia Universidad Javeriana (PUJ)location not on record	5
Chicago, US	5
Loja, EC	5
UTPLlocation not on record	3
Xiamen, CN	3
León, NI	3
South Kensington, GB	3
Harvard Universitylocation not on record	2
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	2
Universidad de Antioquia (UdeA)location not on record	2
QCNElocation not on record	2
Bronx, US	1
University of Stellenboschlocation not on record	1
Cuenca, EC	1
Jardín Botánico José Celestino Mutis (JBBJCM)location not on record	1
Austin, US	1

23 institutions · 167 of 169 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Epidendrum lacustre was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)