Epicoccum nigrum

Link · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Pleosporales/Didymellaceae/Epicoccum

At a glance

Occurrence records3 993

Data sources13

Biological traits0

DNA specimens189

eDNA detections1 789

Sources13 archives

Databases and archives Epicoccum nigrum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 348 records↗

OBISOcean Biodiversity Information System1 645 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 789 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics189 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS121 compounds

Occurrence & distributionGBIF · OBIS3 993 records

Environmental DNA6 datasets · 19 countries1 789 detections

DNA & barcodingBOLD · NCBI189 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Epicoccum nigrum is a species of fungus in the phylum Ascomycota. A plant pathogen and endophyte, it is a widespread fungus which produces coloured pigments that can be used as antifungal agents against other pathogenic fungi. The fluorescent stain epicocconone is extracted from it.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition121 compounds

Compounds documented for Epicoccum nigrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Thiodiketopiperazine alkaloids72

Phthalide derivatives9

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids5

Carotenoids (C40, β-Ψ)4

Flavones3

Documented compounds121 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-5-hydroxydiphenylalazine A	present	LOTUS
(-)-5-hydroxydiphenylalazine A	present	LOTUS
(1R,14S)-20,21,25-trimethoxy-30-methyl-7,23-dioxa-15,30-diazaheptacyclo[22.6.2.23,6.18,12.114,18.027,31.022,33]hexatriaconta-3(36),4,6(35),8,10,12(34),18,20,22(33),24,26,31-dodecaen-9-ol	present	NPASS
(1R,14S)-20,25-dimethoxy-15,30-dimethyl-7,23-dioxa-15,30-diazaheptacyclo[22.6.2.23,6.18,12.114,18.027,31.022,33]hexatriaconta-3(36),4,6(35),8,10,12(34),18,20,22(33),24,26,31-dodecaene-9,21-diol	present	NPASS
(1R,14S)-20,25-dimethoxy-30-methyl-7,23-dioxa-15,30-diazaheptacyclo[22.6.2.23,6.18,12.114,18.027,31.022,33]hexatriaconta-3(36),4,6(35),8,10,12(34),18,20,22(33),24,26,31-dodecaene-9,21-diol	present	NPASS
(1R,14S,15R,16R,19R)-7,15-dihydroxy-21,22-dithia-3,13-diazahexacyclo[14.4.2.01,13.03,11.04,9.014,19]docosa-4(9),5,7,10-tetraene-2,12,18-trione	present	LOTUS
(1R,4S,5R,6R,7R,9R,11R,14S,15R,16S,19R)-5,6,15-trihydroxy-21,22,23-trithia-3,13-diazaheptacyclo[14.4.2.17,11.01,13.03,11.04,9.014,19]tricosane-2,8,12,18-tetrone	present	LOTUS
(1R,4S,5R,6R,7S,9R,11R,14S,15R,16R,19R)-5,6,15-trihydroxy-21,22-dithia-3,13-diazaheptacyclo[14.4.1.17,11.01,13.03,11.04,9.014,19]docosane-2,8,12,18-tetrone	present	LOTUS
(1R,4S,5R,6R,8R,9R,11R,14S,15R,16R,19R)-5,8,15-trihydroxy-21,22,23-trithia-3,13-diazaheptacyclo[14.4.2.16,11.01,13.03,11.04,9.014,19]tricosane-2,12,18-trione	present	LOTUS
(1R,4S,5R,6S,9R,11R,14S,15R,16R,19R)-5,15-dihydroxy-6-methoxy-11-methylsulfanyl-21,22-dithia-3,13-diazahexacyclo[14.4.2.01,13.03,11.04,9.014,19]docosane-2,8,12,18-tetrone	present	LOTUS

05DNA & barcoding189 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epicoccum nigrum has left across the world's sequence archives.

At a glance

DNA specimens189

Marker genes4

GenBank sequences10

eDNA detections1 789

Countries19

The DNA barcodea real sequence read deposited for this species

ITSPV498688.1 ↗471 bpUSA · 2021

ACGT

GAGTACCTTCGTTTCCTCGGCGGGTCCGCCCGCCGATTGGACAACATTCAAACCCTTTGCAGTTGCAATCAGCGTCTGAAAAAACATAAT …

Epicoccum nigrum strain UROL F61 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1★ITS25-8S

fungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Epicoccum nigrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈34 744 152 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Epicoccum nigrum0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness99% BUSCO

08Occurrence & distribution

Record type3 993 records

Wild obs. + sensor388

Museum / vouchered3 577

Cultivated / captive20

Other8

Range

Area of Occupancy AOO1 632 km²

Depth

0–200 m sunlit1 624

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 10 m · 1 624 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy20% within 1 km

≤100 m 60≤1 km 12≤10 km 290>10 km 7

369 georeferenced · 19 without coordinates

Open the mapobservation + sensor388

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 10≤1 km 2≤10 km 36>10 km 10

58 georeferenced · 3 519 without coordinates

Open the institutions mapphysical evidence3 577

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 19 without coordinates

Open the mapnot free-living20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	22
Bronx, US	16
WU-MYClocation not on record	10
Auckland, NZ	10
PHlocation not on record	7
Catholic University of Pekinglocation not on record	6
Uppsala, SE	5
National Institute of Biological Resourceslocation not on record	5
Agriculture and Agri-Food Canada, Canadian Collection of Fungal Cultureslocation not on record	5
IPA/SPlocation not on record	4
BDBClocation not on record	4
ARMS-MBONlocation not on record	4
Centraalbureau voor Schimmelcultureslocation not on record	4
CA	4
ILLSlocation not on record	4
Kew, GB	4
Laboratorio de Ictiologialocation not on record	4
Karlsruhe, DE	3
Slovenian Forestry Institutelocation not on record	3
Mlocation not on record	3
Madison, US	2
Vancouver, CA	2
Sydney Medical Schoollocation not on record	2
Uniwersytet Łódzkilocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	2
San Sebastián, ES	2
nsnflocation not on record	2
Pullman, US	2
Copenhagen, DK	2
Research Collection of Keith Seifertlocation not on record	1
MeiseBGlocation not on record	1
Stockholm, SE	1
Lincoln, US	1
UDEClocation not on record	1
Chapel Hill, US	1
Oulu, FI	1
Chicago, US	1
LDlocation not on record	1
M-VascularPlantslocation not on record	1
Gijón, ES	1
Olocation not on record	1
Trondheim, NO	1
	1
TROMlocation not on record	1
Philadelphia, US	1
TENN-Flocation not on record	1
Champaign, US	1
Tartu, EE	1

49 institutions · 166 of 3 577 vouchered records shown · 1 762 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 789 detections

Where the DNA of Epicoccum nigrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 789

Studies independent surveys6

Countries19

Verifiable raw sequence linked1 624

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 789 detections have coordinates

Open the map19 countries0

Research site; semi-industrial; 9.5 - Subtid…PalearcticIndustrial port; industrial; 9.2 - Subtidal …Marina; semi-industrial; 9.2 - Subtidal Rock…Afrotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 7.70–16.3

Seasonal swing summer↔winter9.40 °C

Max temp (day)13.6 °C 9.10–18.2

Min temp (night)9.90 °C 6.10–14.5

Precipitation94.2 mm/mo 70.9–143

Air humidity64.3 % 63.4–65.2

Vapour deficit507 Pa 368–655

Cloud cover59.5 % 51.7–68.9

CHELSA 1981–2010, ~9 km grid, at location & month of 1 650 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Epicoccum nigrum

At a glance

Sources13 archives

Compound class profile5 classes

Documented compounds121 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 993 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions22 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 993 records