Epichloe festucae

Leuchtm., Schardl & M.R.Siegel · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Hypocreales/Clavicipitaceae/Epichloe

At a glance

Occurrence records74

Data sources9

Biological traits0

DNA specimens4

eDNA detections0

Sources9 archives

Databases and archives Epichloe festucae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS98 compounds

Occurrence & distributionGBIF74 records

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceGoaT · NCBI35 Mbp

01Narrative

Neotyphodium lolii est une espèce de champignons (Fungi) ascomycètes de la famille des Clavicipitaceae. Ce champignon est proche de l'ergot du seigle. C'est une forme anamorphe. C'est un endophyte symbionte de graminées. Il produit des alcaloïdes toxiques, en particulier l'ergovaline et le lolitrème B. Il peut se transmettre par les semences. La plante contaminée ne présente pas de symptômes extérieurs mais on observe un mycélium flexueux à l'intérieur des organes aériens.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition98 compounds

Compounds documented for Epichloe festucae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones13

Flavones11

Chalcones9

Monomeric stilbenes8

Flavonols7

Documented compounds98 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,6S,8S,11R,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2S)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-ol	present	NPASS
(1S,3R,8S,11S,12S,15R,16R)-7,7,12,16-tetramethyl-15-[(2R)-6-methylhept-5-en-2-yl]pentacyclo[9.7.0.01,3.03,8.012,16]octadecan-6-one	present	NPASS
(2R)-2-[3-[(2E)-3,7-dimethylocta-2,6-dienyl]-4-hydroxyphenyl]-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	NPASS
(2S)-7,4'-Dihydroxy-8-geranylflavanone	present	NPASS
(2S,3R,4S,5S,6R)-2-{5-[(1E)-2-(3,5-Dihydroxyphenyl)ethenyl]-2-hydroxyphenoxy}-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(5aS)-1,3,8-Trihydroxy-5,5,11,11-tetramethyl-5a,6-dihydro-5H,7H,11H-[1]benzofuro[3,4-bc]pyrano[3,2-h]xanthen-7-one	present	NPASS
(E)-1-[(2R,3R)-3,5-dihydroxy-2-methyl-2-(4-methylpent-3-enyl)-3,4-dihydrochromen-6-yl]-3-(4-hydroxyphenyl)prop-2-en-1-one	present	NPASS
(E)-1-[(2S)-5-hydroxy-2-methyl-2-(4-methylpent-3-enyl)chromen-6-yl]-3-(4-hydroxyphenyl)prop-2-en-1-one	present	NPASS
(E)-1-[2,4-dihydroxy-3-[(2E,5S)-5-methoxy-3,7-dimethylocta-2,6-dienyl]phenyl]-3-(4-hydroxyphenyl)prop-2-en-1-one	present	NPASS
(E)-1-[2,4-dihydroxy-3-[(2E,6R)-6-hydroxy-3,7-dimethylocta-2,7-dienyl]phenyl]-3-(3,4-dihydroxyphenyl)prop-2-en-1-one	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Epichloe festucae has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV635370.1 ↗492 bpSpain · 2023

ACGT

TTACACTCCCAAACCCCTGTGAACCTTACCTTTACTGTTGCCTCGGCGGGCACGGCCGCGGACGCCCCCTCGCGGGGGCACCGGGGCCGG …

Epichloe festucae strain Froth isolate UZ_14.23(12) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_032064 ↗ · 60 protein · 25 tRNA

orf197orf407orf448orf154orf240orf288orf181orf210orf321orf173orf99orf149orf110orf206orf126nad2orf774nad3atp9orf247cox2orf319orf311nad4Lnad5orf336+30

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Epichloe festucae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size35 100 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Epichloe festucae0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness96.9% BUSCO

08Occurrence & distribution

Record type74 records

Wild obs. + sensor53

Museum / vouchered21

Range

Area of Occupancy AOO236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 28≤1 km 11≤10 km 13

52 georeferenced · 1 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 1

3 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	5
Kew, GB	2
Olocation not on record	1
Karlsruhe, DE	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Uppsala, SE	1
SLU Artdatabankenlocation not on record	1
Catholic University of Pekinglocation not on record	1
Canberra, AU	1
CABI Bioscience Genetic Resource Collectionlocation not on record	1

10 institutions · 15 of 21 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)