Ephemera vulgata

Linnaeus, 1758 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Ephemeroptera/Ephemeridae/Ephemera

At a glance

Occurrence records17 780

Data sources11

Biological traits2

DNA specimens54

eDNA detections35

Sources11 archives

Databases and archives Ephemera vulgata's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 767 records↗

OBISOcean Biodiversity Information System13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS17 780 records

Environmental DNA3 datasets · 8 countries35 detections

DNA & barcodingBOLD54 specimens

Genome at a glanceGoaT · NCBI≈476 Mbp

01Narrative

E. vulgata nymph Ephemera vulgata is a species of mayfly in the genus Ephemera. This mayfly breeds in stationary water in slow rivers and in ponds, the nymphs developing in the mud.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)saprophagous

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ephemera vulgata has left across the world's sequence archives.

At a glance

DNA specimens54

BINs1

Marker genes1

eDNA detections35

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

103Cmostly conserved

166Amostly conserved

181Avariable

212Cvariable

262Gmostly conserved

304Amostly conserved

343Tmostly conserved

403Cmostly conserved

412Tmostly conserved

466Gmostly conserved

548Tmostly conserved

AACTCTTTATTTTATCTTTGGGGCTTGATCCGGTATAATTGGAACCTCATTAAGCTTATTAATTCGGGCTGAATTAGGGCAGCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.50%

Haplotypes13

BIN1

Most divergent pair1.7%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ephemera sachalinensissame genus13.7%Ephemera orientalissame genus14.7%Ephemera blandasame genus14.7%Ephemera danicasame genus15.2%Ephemera variasame genus15.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ephemera vulgata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈475 500 420 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ephemera vulgata0.48 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99% BUSCO

08Occurrence & distribution

Record type17 780 records

Wild obs. + sensor12 574

Museum / vouchered5 199

Other7

Origin

Native145

Range

Area of Occupancy AOO27 236 km²

Depth

0–200 m sunlit13

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 2.3 m · max 4.8 m · 13 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 4 998≤1 km 1 097≤10 km 3 966>10 km 67

10 128 georeferenced · 2 446 without coordinates

Open the mapobservation + sensor12 574

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 4 458≤1 km 161≤10 km 404>10 km 8

5 031 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence5 199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	602
Kuopio, FI	201
NTNU-VMlocation not on record	194
WAGNlocation not on record	72
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	62
NHMOlocation not on record	40
Tromsø, NO	29
Adam Mickiewicz University in Poznańlocation not on record	28
Zürich, CH	25
Tartu, EE	20
BioFokuslocation not on record	19
Natural History Museum, Londonlocation not on record	17
ZMAAlocation not on record	17
South Kensington, GB	17
Philadelphia, US	15
Helsinki, FI	7
ZSMlocation not on record	6
Provincia di Livornolocation not on record	6
Geneva, CH	4
Paro, BT	4
Dhaka, BD	4
Paris, FR	2
Bavarian State Collection of Zoologylocation not on record	2
Tilburg, NL	2
Montréal, CA	2
Tromso University Museumlocation not on record	1

26 institutions · 1 398 of 5 199 vouchered records shown · 3 788 without an institution code

09Environmental DNA35 detections

Where the DNA of Ephemera vulgata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys3

Countries8

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map8 countries0

Riverriver

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 5.70–18.1

Seasonal swing summer↔winter19.0 °C

Max temp (day)15.5 °C 8.00–22.1

Min temp (night)7.90 °C 2.80–13.7

Precipitation88.3 mm/mo 59.9–132

Air humidity60.3 % 58.4–65.3

Moisture balance-6.00 mm/mo -39.2–61.7

Vapour deficit540 Pa 308–813

Wind speed3.10 m/s 2.30–4.00

Cloud cover41.9 % 33.7–59.5

CHELSA 1981–2010, ~9 km grid, at location & month of 32 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ephemera vulgata

At a glance

Sources11 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type17 780 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 26 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type17 780 records