Eonema pyriforme

(M.P.Christ.) Redhead, Lücking & Lawrey · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hygrophoraceae/Eonema

At a glance

Occurrence records67

Data sources8

Biological traits0

DNA specimens2

eDNA detections12

Sources8 archives

Databases and archives Eonema pyriforme's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility67 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF67 records

Environmental DNA2 datasets · 4 countries12 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Athelia pyriformis ist eine Ständerpilzart aus der Familie der Gewebehautverwandten (Atheliaceae). Sie bildet resupinate, weißliche und schimmelteppichartige Fruchtkörper auf Koniferen, Laubbäumen, deren Blättern sowie auf Gräsern aus. Die bekannte Verbreitung der Art umfasst weite Teile Westeuropas.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Eonema pyriforme has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections12

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMZ159477.1 ↗659 bpUnited Kingdom · 2013

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAAACAAACCGAAGCTAGCCGGGTCGTCGCTGGTCTCCCTCA …

Eonema pyriforme voucher K(M):181597 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS1

fungal barcode

08Occurrence & distribution

Record type67 records

Wild obs. + sensor23

Museum / vouchered44

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 9≤10 km 14

23 georeferenced

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy86% within 1 km

≤100 m 8≤1 km 16≤10 km 4

28 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	8
Helsinki, FI	5
SLU Artdatabankenlocation not on record	5
San Sebastián, ES	2
Kew, GB	2
Göteborg, SE	2
Copenhagen, DK	2
Trondheim, NO	1
Royal Botanic Gardens, Kewlocation not on record	1

9 institutions · 28 of 44 vouchered records shown · 15 without an institution code

09Environmental DNA12 detections

Where the DNA of Eonema pyriforme was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys2

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 4.90–21.4

Seasonal swing summer↔winter18.7 °C

Max temp (day)23.0 °C 7.60–23.2

Min temp (night)14.2 °C -0.1–18.0

Precipitation79.8 mm/mo 57.6–218

Air humidity57.7 % 53.4–65.1

Moisture balance-51.5 mm/mo -112–104

Vapour deficit931 Pa 302–1,181

Wind speed2.60 m/s 2.50–4.50

Cloud cover30.7 % 28.7–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)