Entyloma ficariae

A.A.Fisch.Waldh. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Exobasidiomycetes/Entylomatales/Entylomataceae/Entyloma

At a glance

Occurrence records3 294

Data sources7

Biological traits0

DNA specimens2

eDNA detections9

Sources7 archives

Databases and archives Entyloma ficariae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 294 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 294 records

Environmental DNA6 datasets · 6 countries9 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

De speenkruidbrand is een schimmel behorend tot de familie Entylomataceae. Hij parasiteert op bladeren van het speenkruid. Hij veroorzaakt witte vlekken aan beide zijde van het blad. Aangetaste planten hebben vaak iets kleinere bladeren en produceren minder bloemen dan gezonde planten. Hoewel infectie met deze ziekteverwekker niet systemisch is, komen er vlekken voor op bijna elk blad van de plant en blijft de ziekte jaar na jaar in een klein gebied bestaan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entyloma ficariae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences9

eDNA detections9

Countries6

The DNA barcodea real sequence read deposited for this species

ITSPV581486.1 ↗252 bpChina · 2022

ACGT

AAGTCATAACAAGGTATCTGTAGGTGAACCTGCAGATGGATCATTAGTGAATAACACGGGGTTCCCACTATGTGGGCCCCAACCCCTTCA …

Entyloma ficariae voucher SGB 2022,TangChi 329 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS1

fungal barcode

08Occurrence & distribution

Record type3 294 records

Wild obs. + sensor2 804

Museum / vouchered471

Other19

Range

Area of Occupancy AOO8 536 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 1 042≤1 km 236≤10 km 1 194>10 km 12

2 484 georeferenced · 320 without coordinates

Open the mapobservation + sensor2 804

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 18≤1 km 10≤10 km 34>10 km 17

79 georeferenced · 392 without coordinates

Open the institutions mapphysical evidence471

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	97
Görlitz, DE	85
Karlsruhe, DE	50
Helsinki, FI	39
Uppsala, SE	27
Kew, GB	19
CA	18
DPIlocation not on record	16
WU-MYClocation not on record	16
MeiseBGlocation not on record	13
Bernard Price Institute for Palaeontological Researchlocation not on record	11
Mlocation not on record	8
Stockholm, SE	6
Pullman, US	5
Madison, US	3
GZUlocation not on record	3
Museo Entomologico de Leonlocation not on record	3
MAlocation not on record	3
Chicago, US	2
Tartu, EE	2
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	2
San Sebastián, ES	2
nsnflocation not on record	2
Stockholm, SE	2
SLU Artdatabankenlocation not on record	1
ILLSlocation not on record	1
Auckland, NZ	1
TENN-Flocation not on record	1
Gijón, ES	1
Berlin, DE	1
Trondheim, NO	1
TROMlocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Edinburgh, GB	1

34 institutions · 444 of 471 vouchered records shown · 26 without an institution code

09Environmental DNA9 detections

Where the DNA of Entyloma ficariae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys6

Countries6

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map6 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature1.07 °C

Salinity34.7 PSU

Dissolved oxygen6.59 mg/L

Depth4,992 m

Pelagic

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 2.80–21.0

Seasonal swing summer↔winter16.7 °C

Max temp (day)12.2 °C 5.50–24.1

Min temp (night)5.60 °C 0.8–17.4

Precipitation71.5 mm/mo 42.7–110

Air humidity63.0 % 58.8–64.5

Moisture balance-3.90 mm/mo

Vapour deficit439 Pa 351–1,046

Wind speed3.90 m/s

Cloud cover43.3 % 32.4–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Entyloma ficariae

At a glance

Sources7 archives

At a glance

Record type3 294 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type3 294 records