Entomophaga maimaiga — The Life Data

Fungi/Entomophthoromycota/Entomophthoromycetes/Entomophthorales/Entomophthoraceae/Entomophaga

At a glance

Occurrence records30

Data sources8

Biological traits0

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Entomophaga maimaiga's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Entomophaga maimaiga is a Japanese fungus which has shown striking success in managing spongy moth populations in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entomophaga maimaiga has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

ITSJQ294071.1 ↗603 bpGeorgia

ACGT

GTTTTTGAACGCACATTGCACCGACAGTTTACTGTTGGTTTGTTTGTTTGAATTGCTTGAAATACATCTCAAGGGTCTCATATATGTTTG …

UNVERIFIED: Entomophaga maimaiga strain b 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor24

Museum / vouchered6

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 7≤1 km 3≤10 km 5>10 km 3

18 georeferenced · 6 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA7 detections

Where the DNA of Entomophaga maimaiga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.90 °C 2.60–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)14.0 °C 5.60–18.4

Min temp (night)5.60 °C -2.00–8.20

Precipitation79.6 mm/mo 58.1–344

Air humidity58.9 % 57.3–64.9

Moisture balance-24.2 mm/mo -38.4–263

Vapour deficit580 Pa 396–733

Wind speed4.40 m/s 2.50–5.80

Cloud cover40.6 % 36.7–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.