Entoloma vindobonense

Noordel. & Hauskn. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records203

Data sources8

Biological traits0

DNA specimens10

eDNA detections10

Sources8 archives

Databases and archives Entoloma vindobonense's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility203 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF203 records

Environmental DNA4 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

De zwartbruine satijnzwam is een schimmel die behoort tot de familie Entolomataceae. Hij komt voor op humusarme zandgronden en mosrijke duinvalleien.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma vindobonense has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes2

GenBank sequences10

eDNA detections10

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPZ340692.1 ↗574 bpFrance · 2023

ACGT

TGCTGGCTCTTAGGGGCATGTGCACACCGACTCCATTTTTAACCACCTGTGCACCTTGCGTAGATCTGATAATCTCGAGGAAACTCGGTT …

Entoloma vindobonense voucher CORS:FNG/NS/23011322 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type203 records

Wild obs. + sensor150

Museum / vouchered53

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 110≤1 km 4≤10 km 11>10 km 2

127 georeferenced · 23 without coordinates

Open the mapobservation + sensor150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Copenhagen, DK	9
Philadelphia, US	8
California State University, East Baylocation not on record	2
WU-MYClocation not on record	1

4 institutions · 20 of 53 vouchered records shown · 33 without an institution code

09Environmental DNA10 detections

Where the DNA of Entoloma vindobonense was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys4

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

Other Urban/disturbed/developedShrubland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 8.50–15.6

Seasonal swing summer↔winter15.4 °C

Max temp (day)14.5 °C 9.90–18.2

Min temp (night)7.80 °C 5.30–12.8

Precipitation82.8 mm/mo 63.1–174

Air humidity60.4 % 56.9–65.4

Moisture balance38.9 mm/mo

Vapour deficit533 Pa 384–709

Wind speed5.10 m/s

Cloud cover45.7 % 35.6–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)