Entoloma turci

(Bres.) M.M.Moser · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Entolomataceae/Entoloma

At a glance

Occurrence records1 170

Data sources8

Biological traits0

DNA specimens37

eDNA detections46

Sources8 archives

Databases and archives Entoloma turci's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 170 records

Environmental DNA3 datasets · 4 countries46 detections

DNA & barcodingBOLD · NCBI37 specimens

01Narrative

Entoloma turci is a species of fungus found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Entoloma turci has left across the world's sequence archives.

At a glance

DNA specimens37

Marker genes2

GenBank sequences8

eDNA detections46

Countries5

The DNA barcodea real sequence read deposited for this species

ITSMK351757.1 ↗476 bpKyrgyzstan

ACGT

TGAATAACTCTCGAGATGAACTCGGTCCGGGAAACTGCTGTGCTCAATCAATGTGCGGCTTTTCTTGACTTTTCAGATCTATGTTTTCAC …

Entoloma turci voucher KA18-0790 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type1 170 records

Wild obs. + sensor753

Museum / vouchered413

Other4

Range

Area of Occupancy AOO2 544 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 346≤1 km 106≤10 km 216>10 km 3

671 georeferenced · 82 without coordinates

Open the mapobservation + sensor753

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 158≤1 km 79≤10 km 23>10 km 3

263 georeferenced · 150 without coordinates

Open the institutions mapphysical evidence413

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	150
TROMlocation not on record	48
Copenhagen, DK	23
University of Oslo, Natural History Museumlocation not on record	16
WU-MYClocation not on record	15
Tromso University Museumlocation not on record	13
SLU Artdatabankenlocation not on record	10
Göteborg, SE	9
Philadelphia, US	9
Trondheim, NO	8
nsnflocation not on record	6
Uppsala, SE	6
Kew, GB	6
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Oulu, FI	4
Salzburg, AT	4
Tilburg, NL	3
Tartu, EE	3
GJOlocation not on record	2
TUR-Alocation not on record	2
BDBClocation not on record	2
LDlocation not on record	2
San Sebastián, ES	1
HabitatVisionlocation not on record	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Zürich, CH	1
Helsinki, FI	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1

28 institutions · 351 of 413 vouchered records shown · 62 without an institution code

09Environmental DNA46 detections

Where the DNA of Entoloma turci was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys3

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map4 countries0

Grazed mountain slope (30-130 moh).Southern boreal, calcareous pine-spruce forestGammeleng, fuktsig kalkriktSouthern boreal, calcareous pine forestNaturbeitemark, A-verdi, kalkrikt, fuktsig

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 7.00–13.2

Seasonal swing summer↔winter18.6 °C

Max temp (day)12.1 °C 8.20–17.2

Min temp (night)7.70 °C 4.00–10.2

Precipitation136 mm/mo 35.1–182

Air humidity65.2 % 46.5–67.3

Moisture balance75.5 mm/mo -98.8–150

Vapour deficit446 Pa 336–733

Wind speed3.00 m/s 2.00–5.40

Cloud cover51.3 % 36.4–64.9

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Entoloma turci

At a glance

Sources8 archives

At a glance

Record type1 170 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 170 records